Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 407 showing 8121 ~ 8140 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_27136

http://www.addgene.org/27136

Species: Homo sapiens
Genetic Insert: CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259)
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21135224

Proper citation: RRID:Addgene_27136 Copy   


  • RRID:Addgene_27134

http://www.addgene.org/27134

Species: Homo sapiens
Genetic Insert: CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259)
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21135224

Proper citation: RRID:Addgene_27134 Copy   


  • RRID:Addgene_27083

    This resource has 1+ mentions.

http://www.addgene.org/27083

Species: Homo sapiens
Genetic Insert: CK2alpha
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4952; Vector Backbone:pGEX-3X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21036246

Proper citation: RRID:Addgene_27083 Copy   


http://www.addgene.org/27111

Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCS2; Vector Types:xenopus/mammalian/avian/zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Comments: A204 was mutated back to the WT residue on the original pCS2-Flag Smad3 EPSM plasmid.

Proper citation: RRID:Addgene_27111 Copy   


http://www.addgene.org/27110

Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Comments: A213 was mutated back to the wild type residue in EPSM construct

Proper citation: RRID:Addgene_27110 Copy   


  • RRID:Addgene_27085

    This resource has 1+ mentions.

http://www.addgene.org/27085

Species: Homo sapiens
Genetic Insert: CK2beta
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21036246

Proper citation: RRID:Addgene_27085 Copy   


  • RRID:Addgene_27175

    This resource has 1+ mentions.

http://www.addgene.org/27175

Species: Homo sapiens
Genetic Insert: MKL2
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:0; Vector Backbone:p3XFLAG-CMV7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14565952

Proper citation: RRID:Addgene_27175 Copy   


  • RRID:Addgene_27173

    This resource has 10+ mentions.

http://www.addgene.org/27173

Species: Homo sapiens
Genetic Insert: ATF6
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10856300
Comments: This is the activated (nuclear) form of ATF6. Please note that mutation M13I in ATF6 was found during Addgene's quality control. The plasmid should function as described in the associated publication above.

Proper citation: RRID:Addgene_27173 Copy   


  • RRID:Addgene_27101

    This resource has 1+ mentions.

http://www.addgene.org/27101

Species: Homo sapiens
Genetic Insert: αTubulin K40 acetyltransferase
Vector Backbone Description: Backbone Size:4981; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21068373

Proper citation: RRID:Addgene_27101 Copy   


  • RRID:Addgene_27156

    This resource has 1+ mentions.

http://www.addgene.org/27156

Species: Homo sapiens
Genetic Insert: ELK1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732

Proper citation: RRID:Addgene_27156 Copy   


  • RRID:Addgene_27269

http://www.addgene.org/27269

Species: Homo sapiens
Genetic Insert: Septin 5
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4985; Vector Backbone:pGEX6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18385322

Proper citation: RRID:Addgene_27269 Copy   


  • RRID:Addgene_27267

http://www.addgene.org/27267

Species: Homo sapiens
Genetic Insert: REL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17072339
Comments: Please note that Addgene's sequencing results confirmed N424 is present in the REL sequence. Despite the plasmid name, amino acids 425-490 of REL have been deleted. This plasmid is exactly as created by the depositing laboratory and as described in the associated publication listed below and in Chin et al., Oncogene. 2009 May 21;28(20):2100-11.

Proper citation: RRID:Addgene_27267 Copy   


  • RRID:Addgene_27294

    This resource has 1+ mentions.

http://www.addgene.org/27294

Species: Homo sapiens
Genetic Insert: protein kinase B beta
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_27294 Copy   


  • RRID:Addgene_27295

    This resource has 1+ mentions.

http://www.addgene.org/27295

Species: Homo sapiens
Genetic Insert: protein kinase B beta
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Comments: There is a silent mutation at nt552 (CGG->CGA) of the depositor's seq. This mutation does not alter the amino acid sequence.

Proper citation: RRID:Addgene_27295 Copy   


  • RRID:Addgene_27222

http://www.addgene.org/27222

Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253

Proper citation: RRID:Addgene_27222 Copy   


http://www.addgene.org/27419

Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:p2xFlag CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367

Proper citation: RRID:Addgene_27419 Copy   


http://www.addgene.org/27425

Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367

Proper citation: RRID:Addgene_27425 Copy   


http://www.addgene.org/27424

Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367

Proper citation: RRID:Addgene_27424 Copy   


  • RRID:Addgene_27422

    This resource has 1+ mentions.

http://www.addgene.org/27422

Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20868367

Proper citation: RRID:Addgene_27422 Copy   


  • RRID:Addgene_27386

    This resource has 1+ mentions.

http://www.addgene.org/27386

Species: Homo sapiens
Genetic Insert: unligated form of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19965478
Comments: Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A- binding loop. DNA representing the unligated form of this ribozyme was subcloned into pUC19 under a T7 transcription promoter, followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC AC See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was digested with EarI nuclease.

Proper citation: RRID:Addgene_27386 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X