Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHR-ZIP(RK) Resource Report Resource Website |
RRID:Addgene_27136 | CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259) | Homo sapiens | Ampicillin | PMID:21135224 | Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Arginines in the SH2 domains mutated to lysines (R37K/R190K in human ZAP70; R718K/R871K in the insert) | 2026-08-15 01:13:00 | 0 | |
|
pHR-ZIP(WT) Resource Report Resource Website |
RRID:Addgene_27134 | CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259) | Homo sapiens | Ampicillin | PMID:21135224 | Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 0 | ||
|
pDB1 (CK2alpha) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27083 | CK2alpha | Homo sapiens | Ampicillin | PMID:21036246 | Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4952; Vector Backbone:pGEX-3X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 7 | ||
|
pCS2 Flag Smad3 EPSM A204S Resource Report Resource Website |
RRID:Addgene_27111 | Smad3 | Homo sapiens | Ampicillin | PMID:19917253 | A204 was mutated back to the WT residue on the original pCS2-Flag Smad3 EPSM plasmid. | Backbone Size:4000; Vector Backbone:pCS2; Vector Types:xenopus/mammalian/avian/zebrafish; Bacterial Resistance:Ampicillin | T179V S204A S208A S213A; A204S | 2026-08-15 01:12:59 | 0 |
|
pGEX6-Smad3 EPSM A213S Resource Report Resource Website |
RRID:Addgene_27110 | Smad3 | Homo sapiens | Ampicillin | PMID:19917253 | A213 was mutated back to the wild type residue in EPSM construct | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | T179V S204A S208A S213A; A213S | 2026-08-15 01:12:59 | 0 |
|
pAB46 (CK2beta) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27085 | CK2beta | Homo sapiens | Kanamycin | PMID:21036246 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:59 | 1 | ||
|
p3XFLAG-MKL2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27175 | MKL2 | Homo sapiens | Ampicillin | PMID:14565952 | Backbone Marker:Sigma; Backbone Size:0; Vector Backbone:p3XFLAG-CMV7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 3 | ||
|
pCGN-ATF6 (1-373) Resource Report Resource Website 10+ mentions |
RRID:Addgene_27173 | ATF6 | Homo sapiens | Ampicillin | PMID:10856300 | This is the activated (nuclear) form of ATF6. Please note that mutation M13I in ATF6 was found during Addgene's quality control. The plasmid should function as described in the associated publication above. | Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains only aa 1-373 (please see depositor comments below) | 2026-08-15 01:13:00 | 14 |
|
pGEX-αTAT1[2-236] Resource Report Resource Website 1+ mentions |
RRID:Addgene_27101 | αTubulin K40 acetyltransferase | Homo sapiens | Ampicillin | PMID:21068373 | Backbone Size:4981; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 1 | ||
|
pCGN-ELK-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27156 | ELK1 | Homo sapiens | Ampicillin | PMID:20466732 | Backbone Size:0; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 6 | ||
|
GST-SEPT5 WT Resource Report Resource Website |
RRID:Addgene_27269 | Septin 5 | Homo sapiens | Ampicillin | PMID:18385322 | Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4985; Vector Backbone:pGEX6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 0 | ||
|
pcDNA-RELΔ424-490 Resource Report Resource Website |
RRID:Addgene_27267 | REL | Homo sapiens | Ampicillin | PMID:17072339 | Please note that Addgene's sequencing results confirmed N424 is present in the REL sequence. Despite the plasmid name, amino acids 425-490 of REL have been deleted. This plasmid is exactly as created by the depositing laboratory and as described in the associated publication listed below and in Chin et al., Oncogene. 2009 May 21;28(20):2100-11. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of transactivation domain I (aa 425-490) | 2026-08-15 01:13:01 | 0 |
|
pLNCX1 Myr AKT2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27294 | protein kinase B beta | Homo sapiens | Ampicillin | Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | PH domain deleted (aa1-107) | 2026-08-15 01:13:01 | 2 | ||
|
pLNCX1 HA AKT2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27295 | protein kinase B beta | Homo sapiens | Ampicillin | There is a silent mutation at nt552 (CGG->CGA) of the depositor's seq. This mutation does not alter the amino acid sequence. | Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 1 | ||
|
pGEX6-Smad3 EPSM Resource Report Resource Website |
RRID:Addgene_27222 | Smad3 | Homo sapiens | Ampicillin | PMID:19917253 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | T179V S204A S208A S213A | 2026-08-15 01:13:00 | 0 | |
|
p2Flag CMV2-ZO-2-delta-N Resource Report Resource Website |
RRID:Addgene_27419 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Size:4700; Vector Backbone:p2xFlag CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of coding nucleotides from 1-351. This results in N-terminal deletion of 117 amino acids. See Figure 3 in the paper for details. | 2026-08-15 01:13:03 | 0 | |
|
pGEX-4T3-ZO-2-1st-PDZ-delta-NLS Resource Report Resource Website |
RRID:Addgene_27425 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Deletion of NLS-Nuclear Localization Signal: Nucleotides 313-873, counting A in the ATG start codon as 1, are deleted. | 2026-08-15 01:13:03 | 0 | |
|
pGEX-4T3-ZO-2-1st-PDZ Resource Report Resource Website |
RRID:Addgene_27424 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 0 | ||
|
pEGFP-C3-ZO-2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27422 | Zonula Occludens 2 | Homo sapiens | Kanamycin | PMID:20868367 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:02 | 4 | ||
|
p307HU Resource Report Resource Website 1+ mentions |
RRID:Addgene_27386 | unligated form of ligase ribozyme | Homo sapiens | Ampicillin | PMID:19965478 | Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A- binding loop. DNA representing the unligated form of this ribozyme was subcloned into pUC19 under a T7 transcription promoter, followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC AC See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was digested with EarI nuclease. | Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
