Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: human ULK1 shRNA 8
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK1 shRNA 8 TRC candidate.
shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3'
Proper citation: RRID:Addgene_27633 Copy
Species: Homo sapiens
Genetic Insert: DUSP7
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pLEX-HA-MYC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline
Proper citation: RRID:Addgene_27978 Copy
Species: Homo sapiens
Genetic Insert: DUSP7
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pLEX-HA-MYC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline
Proper citation: RRID:Addgene_27976 Copy
Species: Homo sapiens
Genetic Insert: SC4MOL
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline
Comments: Y244C mutation as described in He et al., J Clin Invest. 2011;121(3):976–984. PMID: 21285510
Proper citation: RRID:Addgene_27985 Copy
Species: Homo sapiens
Genetic Insert: SC4MOL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_27980 Copy
Species: Homo sapiens
Genetic Insert: FGD5:HPC09X-H08:C212499
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3MPX.
http://www.thesgc.org/structures/3MPX/
Proper citation: RRID:Addgene_28109 Copy
Species: Homo sapiens
Genetic Insert: BRPF1:JMC014-E01:C44383
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3MO8. https://www.thesgc.org/structures/3MO8/
PDB: 5C6S. https://www.thesgc.org/structures/5C6S
Note that this clone is the same as PDB IDs 3MO8 and 5C6S
Proper citation: RRID:Addgene_28107 Copy
Species: Homo sapiens
Genetic Insert: CYP11A1:HPC09N-C05:C214491
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:6980; Vector Backbone:pCW-LIC (Addgene plasmid 26098); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N9Y. http://www.thesgc.org/structures/3N9Y/
Human CYP11A1 fused with a portion of its cognate redox partner, ferredoxin. The CYP11A1 insert in this plasmid does not contain amino acids a1-40 of GenBank reference sequence NP_000772.2.
Proper citation: RRID:Addgene_28119 Copy
Species: Homo sapiens
Genetic Insert: SUV39H1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB 3MTS: http://www.thesgc.org/structures/3MTS/
Proper citation: RRID:Addgene_28113 Copy
Species: Homo sapiens
Genetic Insert: eGFPhTERT
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBABEhygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12198499
Proper citation: RRID:Addgene_28169 Copy
Species: Homo sapiens
Genetic Insert: ARF1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3O47. http://www.thesgc.org/structures/3O47/
Proper citation: RRID:Addgene_28168 Copy
Species: Homo sapiens
Genetic Insert: EPHB3
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:0; Vector Backbone:pFHMSP-LIC-N (Addgene plasmid 26095); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3P1I. http://www.thesgc.org/structures/3P1I/
Proper citation: RRID:Addgene_28165 Copy
Species: Homo sapiens
Genetic Insert: GTPase IMAP family member 2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3P1J. http://www.thesgc.org/structures/3P1J/
Proper citation: RRID:Addgene_28166 Copy
Species: Homo sapiens
Genetic Insert: UHRF1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2L3R. http://www.thesgc.org/structures/2L3R/
Proper citation: RRID:Addgene_28163 Copy
Species: Homo sapiens
Genetic Insert: membrane protein, palmitoylated 7
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC (Addgene plasmid 26094); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3O46. http://www.thesgc.org/structures/3O46/
Proper citation: RRID:Addgene_28149 Copy
Species: Homo sapiens
Genetic Insert: TRIM24
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_28147 Copy
Species: Homo sapiens
Genetic Insert: TRIM24
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_28148 Copy
Species: Homo sapiens
Genetic Insert: TRIM24
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_28146 Copy
Species: Homo sapiens
Genetic Insert: SND1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB:
http://www.thesgc.org/structures/3OMC/
http://www.thesgc.org/structures/3OMG/
Proper citation: RRID:Addgene_28159 Copy
Species: Homo sapiens
Genetic Insert: Ras homolog enriched in brain like 1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3OES. http://www.thesgc.org/structures/3OES/
Proper citation: RRID:Addgene_28156 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.