Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 409 showing 8161 ~ 8180 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_27633

    This resource has 1+ mentions.

http://www.addgene.org/27633

Species: Homo sapiens
Genetic Insert: human ULK1 shRNA 8
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK1 shRNA 8 TRC candidate. shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3'

Proper citation: RRID:Addgene_27633 Copy   


  • RRID:Addgene_27978

http://www.addgene.org/27978

Species: Homo sapiens
Genetic Insert: DUSP7
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pLEX-HA-MYC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline

Proper citation: RRID:Addgene_27978 Copy   


  • RRID:Addgene_27976

    This resource has 1+ mentions.

http://www.addgene.org/27976

Species: Homo sapiens
Genetic Insert: DUSP7
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pLEX-HA-MYC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline

Proper citation: RRID:Addgene_27976 Copy   


  • RRID:Addgene_27985

http://www.addgene.org/27985

Species: Homo sapiens
Genetic Insert: SC4MOL
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Tetracycline
Comments: Y244C mutation as described in He et al., J Clin Invest. 2011;121(3):976–984. PMID: 21285510

Proper citation: RRID:Addgene_27985 Copy   


  • RRID:Addgene_27980

http://www.addgene.org/27980

Species: Homo sapiens
Genetic Insert: SC4MOL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_27980 Copy   


  • RRID:Addgene_28109

http://www.addgene.org/28109

Species: Homo sapiens
Genetic Insert: FGD5:HPC09X-H08:C212499
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3MPX. http://www.thesgc.org/structures/3MPX/

Proper citation: RRID:Addgene_28109 Copy   


  • RRID:Addgene_28107

http://www.addgene.org/28107

Species: Homo sapiens
Genetic Insert: BRPF1:JMC014-E01:C44383
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3MO8. https://www.thesgc.org/structures/3MO8/ PDB: 5C6S. https://www.thesgc.org/structures/5C6S Note that this clone is the same as PDB IDs 3MO8 and 5C6S

Proper citation: RRID:Addgene_28107 Copy   


  • RRID:Addgene_28119

http://www.addgene.org/28119

Species: Homo sapiens
Genetic Insert: CYP11A1:HPC09N-C05:C214491
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:6980; Vector Backbone:pCW-LIC (Addgene plasmid 26098); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N9Y. http://www.thesgc.org/structures/3N9Y/ Human CYP11A1 fused with a portion of its cognate redox partner, ferredoxin. The CYP11A1 insert in this plasmid does not contain amino acids a1-40 of GenBank reference sequence NP_000772.2.

Proper citation: RRID:Addgene_28119 Copy   


  • RRID:Addgene_28113

    This resource has 1+ mentions.

http://www.addgene.org/28113

Species: Homo sapiens
Genetic Insert: SUV39H1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB 3MTS: http://www.thesgc.org/structures/3MTS/

Proper citation: RRID:Addgene_28113 Copy   


  • RRID:Addgene_28169

    This resource has 1+ mentions.

http://www.addgene.org/28169

Species: Homo sapiens
Genetic Insert: eGFPhTERT
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBABEhygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12198499

Proper citation: RRID:Addgene_28169 Copy   


  • RRID:Addgene_28168

    This resource has 1+ mentions.

http://www.addgene.org/28168

Species: Homo sapiens
Genetic Insert: ARF1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3O47. http://www.thesgc.org/structures/3O47/

Proper citation: RRID:Addgene_28168 Copy   


  • RRID:Addgene_28165

http://www.addgene.org/28165

Species: Homo sapiens
Genetic Insert: EPHB3
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:0; Vector Backbone:pFHMSP-LIC-N (Addgene plasmid 26095); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3P1I. http://www.thesgc.org/structures/3P1I/

Proper citation: RRID:Addgene_28165 Copy   


  • RRID:Addgene_28166

http://www.addgene.org/28166

Species: Homo sapiens
Genetic Insert: GTPase IMAP family member 2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3P1J. http://www.thesgc.org/structures/3P1J/

Proper citation: RRID:Addgene_28166 Copy   


  • RRID:Addgene_28163

    This resource has 1+ mentions.

http://www.addgene.org/28163

Species: Homo sapiens
Genetic Insert: UHRF1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2L3R. http://www.thesgc.org/structures/2L3R/

Proper citation: RRID:Addgene_28163 Copy   


  • RRID:Addgene_28149

http://www.addgene.org/28149

Species: Homo sapiens
Genetic Insert: membrane protein, palmitoylated 7
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC (Addgene plasmid 26094); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3O46. http://www.thesgc.org/structures/3O46/

Proper citation: RRID:Addgene_28149 Copy   


  • RRID:Addgene_28147

http://www.addgene.org/28147

Species: Homo sapiens
Genetic Insert: TRIM24
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_28147 Copy   


  • RRID:Addgene_28148

http://www.addgene.org/28148

Species: Homo sapiens
Genetic Insert: TRIM24
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_28148 Copy   


  • RRID:Addgene_28146

http://www.addgene.org/28146

Species: Homo sapiens
Genetic Insert: TRIM24
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_28146 Copy   


  • RRID:Addgene_28159

http://www.addgene.org/28159

Species: Homo sapiens
Genetic Insert: SND1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: http://www.thesgc.org/structures/3OMC/ http://www.thesgc.org/structures/3OMG/

Proper citation: RRID:Addgene_28159 Copy   


  • RRID:Addgene_28156

http://www.addgene.org/28156

Species: Homo sapiens
Genetic Insert: Ras homolog enriched in brain like 1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3OES. http://www.thesgc.org/structures/3OES/

Proper citation: RRID:Addgene_28156 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X