Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Laconic (LACtate Optical Nano Indicator from CECs)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5418; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression, lactate biosensor; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23469056
Comments: Laconic is a genetically-encoded biosensor that detects lactate in the physiological range. The sensor was based on LldR, a bacterial transcription regulator that consists of a lactate-binding/regulatory domain and a DNA-binding domain. Laconic consists of a N-terminal mTFP, followed by the LldR flanked by linkers, and finally a C-terminal Venus.
See Addgene plasmid# 46307: NLS-Laconic/pCMV-myc-nuc for a nuclear-targeted version of Laconic: http://www.addgene.org/46307/ .
Proper citation: RRID:Addgene_44238 Copy
Species: Homo sapiens
Genetic Insert: PP1B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11739654
Comments: Please note that there is a silent mutation at bp#842 when compared to GenBank reference sequence NM_002709.2.
Proper citation: RRID:Addgene_44223 Copy
Species: Homo sapiens
Genetic Insert: PP-1G
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11739654
Comments: Please note that there is a silent mutation at bp#784 when compared to GenBank reference sequence NM_002710.3.
Proper citation: RRID:Addgene_44225 Copy
Species: Synthetic
Genetic Insert: CBF1-Responsive-Element
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:4540; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23617465
Proper citation: RRID:Addgene_44211 Copy
Species: Homo sapiens
Genetic Insert: RepoMan
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16492807
Proper citation: RRID:Addgene_44213 Copy
Genetic Insert: KanR
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240
Comments: 1nt mismatch at bp#102 which may affect NheI site. Should not effect plasmid function.
Proper citation: RRID:Addgene_39295 Copy
Species: Homo sapiens
Genetic Insert: Myocilin wild-type
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19959812
Proper citation: RRID:Addgene_39326 Copy
Species: synthetic gene
Genetic Insert: MSP1E3D1_D73C
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET 28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19903557
Proper citation: RRID:Addgene_39328 Copy
Genetic Insert: KanR
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240
Proper citation: RRID:Addgene_39292 Copy
Species: Neisseria meningitidis
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:pET-based custom vector; Backbone Size:6400; Vector Backbone:pEC-K-MBP; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22745249
Proper citation: RRID:Addgene_39317 Copy
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5438; Vector Backbone:pET26b(+); Vector Types:Bacterial Expression, Bacterial expression, bacterial expression of recombinant antibody fragments in the form of single chain Fvs (scFvs); Bacterial Resistance:Kanamycin
Defining Citation: PMID:17156422
Proper citation: RRID:Addgene_39264 Copy
Genetic Insert: burs-mCD8-EGFP-T2A-Gal4
Vector Backbone Description: Backbone Size:8491; Vector Backbone:pC-attB; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908
Proper citation: RRID:Addgene_39463 Copy
Genetic Insert: mCD8-D2A-Gal4
Vector Backbone Description: Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908
Proper citation: RRID:Addgene_39457 Copy
Species: Homo sapiens
Genetic Insert: HA-hTet1CDmu
Vector Backbone Description: Backbone Size:5321; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21496894
Proper citation: RRID:Addgene_39455 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-45-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCAAGTCCGCCATGCCCGA
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb
Proper citation: RRID:Addgene_39446 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-36-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCACCGGGGTGGTGCCCA
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb
Proper citation: RRID:Addgene_39428 Copy
Species: Homo sapiens
Genetic Insert: HRAS V12
Vector Backbone Description: Backbone Marker:Addgene plasmid #1764; Vector Backbone:pBABE-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39526 Copy
Species: Homo sapiens
Genetic Insert: ARAP3(R307,8A)
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11804589
Proper citation: RRID:Addgene_39486 Copy
Species: Homo sapiens
Genetic Insert: ARAP3
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11804589
Proper citation: RRID:Addgene_39484 Copy
Species: Homo sapiens
Genetic Insert: TP53
Vector Backbone Description: Backbone Marker:Amersham; Vector Backbone:pGEX-6p-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21900401
Comments: Please note that the p53 insert in this plasmid contains a known P72R variant when compared to GenBank ID NP_000537.3
Proper citation: RRID:Addgene_39479 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
