Plasmids   Select Another Resource Report Type

http://www.addgene.org/55127

Species: Homo sapiens
Genetic Insert: Rab7a
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55127 Copy   

•   Source: Addgene

http://www.addgene.org/55126

Species: Other
Genetic Insert: Rab5a
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55126 Copy   

•   Source: Addgene

http://www.addgene.org/55129

Species: Homo sapiens
Genetic Insert: Sec61
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55129 Copy   

•   Source: Addgene

http://www.addgene.org/55139

Species: Mus musculus
Genetic Insert: Talin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22751201
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55139 Copy   

•   Source: Addgene

http://www.addgene.org/55134

Species: Mus musculus
Genetic Insert: Smoothened1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55134 Copy   

•   Source: Addgene

http://www.addgene.org/55132

Species: Homo sapiens
Genetic Insert: Sequestosome1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55132 Copy   

•   Source: Addgene

http://www.addgene.org/55146

Species: Homo sapiens
Genetic Insert: TOMM20
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55146 Copy   

•   Source: Addgene

http://www.addgene.org/55144

Species: Homo sapiens
Genetic Insert: TFR
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55144 Copy   

•   Source: Addgene

http://www.addgene.org/55143

Species: Homo sapiens
Genetic Insert: Tensin1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55143 Copy   

•   Source: Addgene

http://www.addgene.org/55162

Species: Mus musculus
Genetic Insert: WASH1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: WASH = WASH1. Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55162 Copy   

•   Source: Addgene

http://www.addgene.org/55215

Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2RRT has a TEV-cleavable N-terminal StrepII-StrepII tag. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

Proper citation: RRID:Addgene_55215 Copy   

•   Source: Addgene

http://www.addgene.org/55211

Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2-HpI-68 has a TEV-cleavable N-terminal His6-High pI protein fusion tag. The high pI can improve solubility of your target protein.To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

Proper citation: RRID:Addgene_55211 Copy   

•   Source: Addgene

http://www.addgene.org/55219

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-B has a TEV cleavable His6 at the N-terminus. The 438-B vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55219 Copy   

•   Source: Addgene

http://www.addgene.org/55218

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-A is an untagged pFastBac LIC Subcloning vector. The 438 vectors use the LICvBac Forward primer and the LICv1 Reverse primer. LICvBacF - 5'-TACTTCCAATCCAATCG-3' (Note: ATG must be added to ORF) LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55218 Copy   

•   Source: Addgene

http://www.addgene.org/55184

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:6063; Vector Backbone:pFastBac; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55184 Copy   

•   Source: Addgene

http://www.addgene.org/55221

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-Rgfp has a TEV cleavable StrepII and msfGFP at the N-terminus. The 438-Rgfp vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55221 Copy   

•   Source: Addgene

http://www.addgene.org/63596

Species: S. pyogenes
Genetic Insert: humanized S. pyogenes dCas9
Vector Backbone Description: Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25997509

Proper citation: RRID:Addgene_63596 Copy   

•   Source: Addgene

http://www.addgene.org/63592

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25748654
Comments: Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.

Proper citation: RRID:Addgene_63592 Copy   

•   Source: Addgene

http://www.addgene.org/63556

Species: Leishmania
Genetic Insert: guide sequence
Vector Backbone Description: Vector Backbone:pSPneo; Vector Types:Leishmania Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26199327
Comments: The guide sequence will be cloned into the two Bbs I sites ( See attached map). This plasmid contains secondary structure and needs to be sequenced with a modified protocol.

Proper citation: RRID:Addgene_63556 Copy   

•   Source: Addgene

http://www.addgene.org/63569

Species: Mus musculus
Genetic Insert: Bicaudal D protein
Vector Backbone Description: Backbone Size:7041; Vector Backbone:pBa-eGFP-FKBP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25624392
Comments: pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

Proper citation: RRID:Addgene_63569 Copy   

•   Source: Addgene