Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Laconic/pcDNA3.1(-) Resource Report Resource Website 10+ mentions |
RRID:Addgene_44238 | Laconic (LACtate Optical Nano Indicator from CECs) | Synthetic | Ampicillin | PMID:23469056 | Laconic is a genetically-encoded biosensor that detects lactate in the physiological range. The sensor was based on LldR, a bacterial transcription regulator that consists of a lactate-binding/regulatory domain and a DNA-binding domain. Laconic consists of a N-terminal mTFP, followed by the LldR flanked by linkers, and finally a C-terminal Venus. See Addgene plasmid# 46307: NLS-Laconic/pCMV-myc-nuc for a nuclear-targeted version of Laconic: http://www.addgene.org/46307/ . | Backbone Marker:Invitrogen; Backbone Size:5418; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression, lactate biosensor; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:14 | 40 | |
|
pEGFP(N3)-PP1beta Resource Report Resource Website 1+ mentions |
RRID:Addgene_44223 | PP1B | Homo sapiens | Kanamycin | PMID:11739654 | Please note that there is a silent mutation at bp#842 when compared to GenBank reference sequence NM_002709.2. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:14 | 6 | |
|
pEGFP(C1)-PP1gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_44225 | PP-1G | Homo sapiens | Kanamycin | PMID:11739654 | Please note that there is a silent mutation at bp#784 when compared to GenBank reference sequence NM_002710.3. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:13 | 6 | |
|
CBF:H2B-Venus Resource Report Resource Website 1+ mentions |
RRID:Addgene_44211 | CBF1-Responsive-Element | Synthetic | Kanamycin | PMID:23617465 | Backbone Marker:clontech; Backbone Size:4540; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:13 | 3 | ||
|
pEGFP(C1)-RepoMan/RAXA Resource Report Resource Website 1+ mentions |
RRID:Addgene_44213 | RepoMan | Homo sapiens | Kanamycin | PMID:16492807 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | V393A/F395A | 2026-08-15 01:15:14 | 1 | |
|
pFA6a-3HA-kanMX6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39295 | KanR | Ampicillin | PMID:9717240 | 1nt mismatch at bp#102 which may affect NheI site. Should not effect plasmid function. | Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 6 | ||
|
pMYOCWT-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_39326 | Myocilin wild-type | Homo sapiens | Kanamycin | PMID:19959812 | Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:27 | 1 | ||
|
pMSP1E3D1_D73C Resource Report Resource Website 1+ mentions |
RRID:Addgene_39328 | MSP1E3D1_D73C | synthetic gene | Kanamycin | PMID:19903557 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET 28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | cys mutant of MSP1E3D1 | 2026-08-15 01:14:27 | 1 | |
|
pFA6a-GFP(S65T)-kanMX6 Resource Report Resource Website 10+ mentions |
RRID:Addgene_39292 | KanR | Ampicillin | PMID:9717240 | Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 12 | |||
|
pMJ839 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39317 | Cas9 | Neisseria meningitidis | Kanamycin | PMID:22745249 | Backbone Marker:pET-based custom vector; Backbone Size:6400; Vector Backbone:pEC-K-MBP; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:27 | 1 | ||
|
pSANG10-3F Resource Report Resource Website 1+ mentions |
RRID:Addgene_39264 | Kanamycin | PMID:17156422 | Backbone Marker:EMD Biosciences; Backbone Size:5438; Vector Backbone:pET26b(+); Vector Types:Bacterial Expression, Bacterial expression, bacterial expression of recombinant antibody fragments in the form of single chain Fvs (scFvs); Bacterial Resistance:Kanamycin | 2026-08-15 01:14:26 | 6 | ||||
|
pC-attB-burs-mCD8-EGFP-T2A-Gal4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39463 | burs-mCD8-EGFP-T2A-Gal4 | Ampicillin | PMID:22209908 | Backbone Size:8491; Vector Backbone:pC-attB; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 2 | |||
|
pPac-PL-mCD8-D2A-Gal4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39457 | mCD8-D2A-Gal4 | Ampicillin | PMID:22209908 | Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 1 | |||
|
pAAV-EF1a-HA-hTet1CDmu-WPRE-PolyA Resource Report Resource Website 1+ mentions |
RRID:Addgene_39455 | HA-hTet1CDmu | Homo sapiens | Ampicillin | PMID:21496894 | Backbone Size:5321; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | aa1418–2136 with mutations H1672 to Y, 1674D to A | 2026-08-15 01:14:28 | 4 | |
|
TAL2076 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39446 | eGFP-TALEN-45-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTCAAGTCCGCCATGCCCGA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 1 | |
|
TAL2094 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39428 | eGFP-TALEN-36-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCACCGGGGTGGTGCCCA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 1 | |
|
pBABEpuro-H-RAS_V12 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39526 | HRAS V12 | Homo sapiens | Ampicillin | Backbone Marker:Addgene plasmid #1764; Vector Backbone:pBABE-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | V12 = G12V | 2026-08-15 01:14:29 | 2 | ||
|
pEGFP-ARAP3(R307,8A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_39486 | ARAP3(R307,8A) | Homo sapiens | Kanamycin | PMID:11804589 | Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | R307,8A = PH domain mutation | 2026-08-15 01:14:28 | 1 | |
|
pEGFP-ARAP3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39484 | ARAP3 | Homo sapiens | Kanamycin | PMID:11804589 | Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:28 | 2 | ||
|
pGEX-p53 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39479 | TP53 | Homo sapiens | Ampicillin | PMID:21900401 | Please note that the p53 insert in this plasmid contains a known P72R variant when compared to GenBank ID NP_000537.3 | Backbone Marker:Amersham; Vector Backbone:pGEX-6p-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | P72R | 2026-08-15 01:14:28 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
