Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rabies virus
Genetic Insert: SADB19P
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Proper citation: RRID:Addgene_32631 Copy
Genetic Insert: IRES-EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P3-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: BMC Biotechnol. 2006 Jan 12;6:4.
Development of a new bicistronic retroviral vector with strong IRES activity.
Martin P, Albagli O, Poggi MC, Boulukos KE, Pognonec P.
Source
CNRS UMR6548, Parc Valrose, Université de Nice Sophia Antipolis, Nice, France. [email protected]
Proper citation: RRID:Addgene_32591 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Addgene plasmid 32634; Backbone Size:15428; Vector Backbone:pSADdeltaG; Vector Types:Mammalian Expression, Rabies virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Comments: The genes which replaced GFP in the pcDNA-SADdeltaG-GFP plasmid were amplified by
PCR using plasmids encoding mCherry and primer pairs with BamHI and NheI/NotI
sequences at the ends.
Proper citation: RRID:Addgene_32636 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Addgene plasmid 32634; Backbone Size:15428; Vector Backbone:pSADdeltaG; Vector Types:Mammalian Expression, Rabies virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Comments: The genes which replaced GFP in the pcDNA-SADdeltaG-GFP plasmid were amplified by
PCR using plasmids encoding mCherry and primer pairs with BamHI and NheI/NotI
sequences at the ends.
Proper citation: RRID:Addgene_32637 Copy
Species: Rabies virus
Genetic Insert: B19N, B19P, B19M and B19L
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Comments: To construct the rabies virus genomic cDNA, several pieces of rabies genomic cDNA were ligated with unique restriction enzyme sites, AgeI, MluI, BlpI, BstZ17I, and BstBI. Addition of HamRz and HdvRz sequences were performed by PCR using synthesized primers designed to attach these ribozyme sequences.
The pSADdeltaG-F3 has 3 unique restriction enzyme sites Sbf1, Srf1 and NheI for cloning the first gene and 3 unique restriction enzyme sites PacI, AscI and SacII for cloning the second gene between B19M and B19L.
Proper citation: RRID:Addgene_32634 Copy
Genetic Insert: DsRed2
Vector Backbone Description: Backbone Marker:Addgene plasmid 32634; Backbone Size:15428; Vector Backbone:pSADdeltaG; Vector Types:Mammalian Expression, Rabies virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Proper citation: RRID:Addgene_32638 Copy
Genetic Insert: Intronic Luciferase miRNA and EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P3-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: LucmiRNA atttgtattcagcccatatcgg
Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.
Proper citation: RRID:Addgene_32588 Copy
Species: Gallus gallus
Genetic Insert: GAPDH shRNA #2
Vector Backbone Description: Vector Backbone:pRFP RNAiC-1; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21060789
Proper citation: RRID:Addgene_32622 Copy
Genetic Insert: Intronic HCN1miRNA and EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P4r-P3r; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: HCN1miRNA TAAAGACGACAGTAGGTATCAG
Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.
Proper citation: RRID:Addgene_32586 Copy
Species: Gallus gallus
Genetic Insert: TRbeta shRNA #1
Vector Backbone Description: Vector Backbone:pRFP RNAiC-1; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21060789
Proper citation: RRID:Addgene_32620 Copy
Genetic Insert: Sce
Vector Backbone Description: Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21743461
Proper citation: RRID:Addgene_32628 Copy
Species: Homo sapiens
Genetic Insert: CCND1 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372
Proper citation: RRID:Addgene_32731 Copy
Species: Homo sapiens
Genetic Insert: CCND1 Promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372
Proper citation: RRID:Addgene_32732 Copy
Species: Homo sapiens
Genetic Insert: DCX
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed2-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15173193
Proper citation: RRID:Addgene_32851 Copy
Species: Homo sapiens
Genetic Insert: CCND1 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372
Proper citation: RRID:Addgene_32734 Copy
Species: Mus musculus
Genetic Insert: Talin 1 Rod aa 434-2541
Vector Backbone Description: Backbone Marker:BD Clontech; Backbone Size:4749; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17114441
Comments: Please note that both the full plasmid sequence from the depositing laboratory and Addgene's sequencing results indicate a K673N mutation/SNP when the sequences are compared to GenBank entry NP_035732.2. The depositing laboratory states that this difference is not a concern for the function of the plasmid. The most appropriate reference sequence for the Talin1 insert in the plasmid is GenBank accession number CAA39588.1.
Proper citation: RRID:Addgene_32855 Copy
Species: Homo sapiens
Genetic Insert: TCF4E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372
Proper citation: RRID:Addgene_32739 Copy
Species: Homo sapiens
Genetic Insert: CCND1 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372
Comments: There is a 1bp mismatch in the sequence that does not affect plasmid function.
Proper citation: RRID:Addgene_32737 Copy
Species: Homo sapiens
Genetic Insert: MLH1
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3RBN. http://www.thesgc.org/structures/3RBN/
Proper citation: RRID:Addgene_32859 Copy
Species: Chlamydomonas reinhardtii
Genetic Insert: oChiEF
Vector Backbone Description: Backbone Marker:Addgene plasmid 20071; Backbone Size:4885; Vector Backbone:pACAGW-ChR2-Venus-AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23029198
Comments: Please note this plasmid has a I170V in channelopsin 1. The changed amino acid improves the protein’s function.
Proper citation: RRID:Addgene_32846 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
