Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: gEEH_04
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80688 Copy
Species: Synthetic
Genetic Insert: gEEEH_04
Vector Backbone Description: Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27626386
Proper citation: RRID:Addgene_80687 Copy
Species: Synthetic
Genetic Insert: PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
Vector Backbone Description: Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28179459
Proper citation: RRID:Addgene_80767 Copy
Species: Synthetic
Genetic Insert: CRISPR gRNA expression cassette (for SpCas9)
Vector Backbone Description: Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27178736
Proper citation: RRID:Addgene_80792 Copy
Species: Synthetic
Genetic Insert: CRISPR gRNA expression cassette (for SpCas9)
Vector Backbone Description: Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27178736
Proper citation: RRID:Addgene_80789 Copy
Species: Synthetic
Genetic Insert: CRISPR gRNA expression cassette (for SpCas9)
Vector Backbone Description: Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27178736
Proper citation: RRID:Addgene_80788 Copy
Species: Synthetic
Genetic Insert: 3xFLAG-piggyBac-DsRed
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR™4-TOPO; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin
Proper citation: RRID:Addgene_80820 Copy
Species: Synthetic
Genetic Insert: CRISPR gRNA expression cassette (for SpCas9)
Vector Backbone Description: Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27178736
Proper citation: RRID:Addgene_80786 Copy
Species: Synthetic
Genetic Insert: CRISPR gRNA expression cassette (for SpCas9)
Vector Backbone Description: Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27178736
Proper citation: RRID:Addgene_80785 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80859 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80914 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80913 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80912 Copy
Species: Synthetic
Genetic Insert: Cas9N
Vector Backbone Description: Backbone Marker:University of Pennsylvannia; Backbone Size:3000; Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27595405
Proper citation: RRID:Addgene_80937 Copy
Species: Synthetic
Genetic Insert: Cas9N
Vector Backbone Description: Backbone Marker:Lonza; Backbone Size:2900; Vector Backbone:pMAX; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27595405
Proper citation: RRID:Addgene_80934 Copy
Species: Synthetic
Genetic Insert: Cas9C
Vector Backbone Description: Backbone Marker:University of Pennsylvannia; Backbone Size:3000; Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27595405
Proper citation: RRID:Addgene_80931 Copy
Species: Synthetic
Genetic Insert: LoxP-3xP3-DsRed-LoxP
Vector Backbone Description: Backbone Marker:DNA 2.0; Backbone Size:27848; Vector Backbone:pJ204; Vector Types:high copy, amp resistance; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_80926 Copy
Species: Synthetic
Genetic Insert: LOV2
Vector Backbone Description: Backbone Size:5040; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27427858
Proper citation: RRID:Addgene_81009 Copy
Species: Synthetic
Genetic Insert: HA tag
Vector Backbone Description: Backbone Marker:Veit Hornung group; Vector Backbone:pCRISPaint; Vector Types:gene tagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27465542
Proper citation: RRID:Addgene_80959 Copy
Species: Synthetic
Genetic Insert: AviTag
Vector Backbone Description: Backbone Marker:Veit Hornung group; Vector Backbone:pCRISPaint; Vector Types:gene tagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27465542
Proper citation: RRID:Addgene_80957 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
