Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:synthetic (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

30,615 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCDB185
 
Resource Report
Resource Website
RRID:Addgene_80688 gEEH_04 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-01 10:02:55 0
pCDB285
 
Resource Report
Resource Website
RRID:Addgene_80687 gEEEH_04 Synthetic Kanamycin PMID:27626386 Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-01 10:02:55 0
pDonor-tBFP-NLS-Neo (Universal)
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_80767 PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT) Synthetic Kanamycin PMID:28179459 Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-09-01 10:02:55 19
pMA-SpCas9-g9
 
Resource Report
Resource Website
RRID:Addgene_80792 CRISPR gRNA expression cassette (for SpCas9) Synthetic Ampicillin PMID:27178736 Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:02:55 0
pMA-SpCas9-g6
 
Resource Report
Resource Website
RRID:Addgene_80789 CRISPR gRNA expression cassette (for SpCas9) Synthetic Ampicillin PMID:27178736 Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:02:55 0
pMA-SpCas9-g5
 
Resource Report
Resource Website
RRID:Addgene_80788 CRISPR gRNA expression cassette (for SpCas9) Synthetic Ampicillin PMID:27178736 Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:02:55 0
pScarlessHD-3xFLAG-DsRed
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80820 3xFLAG-piggyBac-DsRed Synthetic Ampicillin and Kanamycin Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR™4-TOPO; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-01 10:02:56 4
pMA-SpCas9-g3
 
Resource Report
Resource Website
RRID:Addgene_80786 CRISPR gRNA expression cassette (for SpCas9) Synthetic Ampicillin PMID:27178736 Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:02:55 0
pMA-SpCas9-g2
 
Resource Report
Resource Website
RRID:Addgene_80785 CRISPR gRNA expression cassette (for SpCas9) Synthetic Ampicillin PMID:27178736 Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:02:55 0
pJPC12-ΔM13-mCherry-PR/PRM-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80859 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-01 10:02:56 2
pJPC12-ΔM13-mCherry-P/PM,4A5C6G7G-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80914 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-01 10:02:57 1
pJPC12-ΔM13-mCherry-P/PM,4A5T6T-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80913 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-01 10:02:57 1
pJPC12-ΔM13-mCherry-P/PM,5G6T-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80912 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-01 10:02:57 1
pAAV-SMVP-Cas9N-U6-gRNA M4
 
Resource Report
Resource Website
RRID:Addgene_80937 Cas9N Synthetic Ampicillin PMID:27595405 Backbone Marker:University of Pennsylvannia; Backbone Size:3000; Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 10:02:57 0
pSMVP-Cas9N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80934 Cas9N Synthetic Kanamycin PMID:27595405 Backbone Marker:Lonza; Backbone Size:2900; Vector Backbone:pMAX; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-09-01 10:02:57 2
pAAV-SMVP-Cas9C
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_80931 Cas9C Synthetic Ampicillin PMID:27595405 Backbone Marker:University of Pennsylvannia; Backbone Size:3000; Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 10:02:57 1
pHD-DsRed-w+
 
Resource Report
Resource Website
RRID:Addgene_80926 LoxP-3xP3-DsRed-LoxP Synthetic Ampicillin Backbone Marker:DNA 2.0; Backbone Size:27848; Vector Backbone:pJ204; Vector Types:high copy, amp resistance; Bacterial Resistance:Ampicillin 2026-09-01 10:02:57 0
pTriEx-NTOM20-LOV2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_81009 LOV2 Synthetic Ampicillin PMID:27427858 Backbone Size:5040; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin 2026-09-01 10:02:58 9
pCRISPaint-HA-PuroR
 
Resource Report
Resource Website
RRID:Addgene_80959 HA tag Synthetic Ampicillin PMID:27465542 Backbone Marker:Veit Hornung group; Vector Backbone:pCRISPaint; Vector Types:gene tagging; Bacterial Resistance:Ampicillin 2026-09-01 10:02:57 0
pCRISPaint-AviTag-PuroR
 
Resource Report
Resource Website
RRID:Addgene_80957 AviTag Synthetic Ampicillin PMID:27465542 Backbone Marker:Veit Hornung group; Vector Backbone:pCRISPaint; Vector Types:gene tagging; Bacterial Resistance:Ampicillin 2026-09-01 10:02:57 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.