Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 414 showing 8261 ~ 8280 out of 740,326 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/179110

Genetic Insert: TP901-1 Integrase
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36424489
Comments: Please visit https://doi.org/10.1101/2021.11.01.466786 for bioRxiv preprint.

Proper citation: RRID:Addgene_179110 Copy   


  • RRID:Addgene_178975

http://www.addgene.org/178975

Species: Synthetic
Genetic Insert: GST-His8-GFP-nanobody
Vector Backbone Description: Backbone Marker:Cytiva; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_178975 Copy   


  • RRID:Addgene_1790

    This resource has 1+ mentions.

http://www.addgene.org/1790

Species: Homo sapiens
Genetic Insert: FOXO3a
Vector Backbone Description: Backbone Size:4968; Vector Backbone:pGex 4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10102273
Comments: See author's sequence and map.

Proper citation: RRID:Addgene_1790 Copy   


  • RRID:Addgene_179143

http://www.addgene.org/179143

Species: Synthetic
Genetic Insert: Sec61b-V5-TurboID
Vector Backbone Description: Backbone Marker:Tong-Chuan He laboratory; Backbone Size:35725; Vector Backbone:pAdTrack-CMV, pAdEasy-1; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34471136
Comments: Sec61b-V5-TurboID_pcDNA5 is Addgene plasmid # 166971. To generate adenovirus, digest with PacI and perform transfection to HEK293 cells according to Luo et al (PMID:17546019) procedure #14. Please note: The plasmid contains a 1650bp insertion just downstream of the Left Arm compared to the depositor's provided sequence. This difference is not known to affect plasmid function.

Proper citation: RRID:Addgene_179143 Copy   


  • RRID:Addgene_178963

http://www.addgene.org/178963

Species: Danio rerio
Genetic Insert: Glial fibrillary acidic protein promoter
Vector Backbone Description: Backbone Size:3323; Vector Backbone:pminiTol2; Vector Types:Tol2 mediated recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28882119

Proper citation: RRID:Addgene_178963 Copy   


  • RRID:Addgene_178964

http://www.addgene.org/178964

Species: Danio rerio
Genetic Insert: Glial fibrillary acidic protein promoter
Vector Backbone Description: Backbone Size:3323; Vector Backbone:pminiTol2; Vector Types:Tol2 mediated recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28882119

Proper citation: RRID:Addgene_178964 Copy   


  • RRID:Addgene_179097

    This resource has 1+ mentions.

http://www.addgene.org/179097

Species: Synthetic
Genetic Insert: ABE8e
Vector Backbone Description: Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179097 Copy   


  • RRID:Addgene_179094

http://www.addgene.org/179094

Species: Synthetic
Genetic Insert: SpRY
Vector Backbone Description: Vector Backbone:pRDA_085; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179094 Copy   


  • RRID:Addgene_17921

http://www.addgene.org/17921

Species: Homo sapiens
Genetic Insert: shFEN
Vector Backbone Description: Backbone Size:7200; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18394896
Comments: Target sequence: TCACTAAGCAGCACAATGAT

Proper citation: RRID:Addgene_17921 Copy   


  • RRID:Addgene_179095

    This resource has 1+ mentions.

http://www.addgene.org/179095

Species: Synthetic
Genetic Insert: BE3.9 (Cas9-NG)
Vector Backbone Description: Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179095 Copy   


  • RRID:Addgene_179098

    This resource has 1+ mentions.

http://www.addgene.org/179098

Species: Synthetic
Genetic Insert: ABE8e (Cas9-NG)
Vector Backbone Description: Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179098 Copy   


http://www.addgene.org/179131

Species: Mus musculus
Genetic Insert: spermatogenesis associated 33
Vector Backbone Description: Backbone Size:5211; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34446558

Proper citation: RRID:Addgene_179131 Copy   


  • RRID:Addgene_179099

    This resource has 1+ mentions.

http://www.addgene.org/179099

Species: Synthetic
Genetic Insert: ABE8e (SpG)
Vector Backbone Description: Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179099 Copy   


http://www.addgene.org/179132

Species: Mus musculus
Genetic Insert: spermatogenesis associated 33
Vector Backbone Description: Backbone Size:5211; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34446558

Proper citation: RRID:Addgene_179132 Copy   


  • RRID:Addgene_179328

http://www.addgene.org/179328

Species: Homo sapiens
Genetic Insert: WWP1 F792D
Vector Backbone Description: Backbone Marker:GEHealthcare; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Best yields for protein purification were found in BL21 (DE) cells using an overnight induction at 16C

Proper citation: RRID:Addgene_179328 Copy   


http://www.addgene.org/179440

Species: Homo sapiens
Genetic Insert: H2B-mIFP-T2A-rTetR-HDAC4
Vector Backbone Description: Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35678392
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_179440 Copy   


http://www.addgene.org/179439

Species: Homo sapiens
Genetic Insert: H2B-mIFP-T2A-rTetR-KRAB
Vector Backbone Description: Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35678392
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_179439 Copy   


  • RRID:Addgene_179391

http://www.addgene.org/179391

Species: Homo sapiens
Genetic Insert: ELMSAN1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5367; Vector Backbone:pET28C (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34912035
Comments: The insert encodes the epitope (ELMSAN1 residue 550-600) of the antibody (Catalog # A303-157A, BETHYL). Expressed protein has been confirmed by Western blot.

Proper citation: RRID:Addgene_179391 Copy   


  • RRID:Addgene_179271

http://www.addgene.org/179271

Vector Backbone Description: Backbone Marker:Takara; Backbone Size:7304; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32984337

Proper citation: RRID:Addgene_179271 Copy   


  • RRID:Addgene_179276

    This resource has 1+ mentions.

http://www.addgene.org/179276

Species: Clostridium cellulosi
Genetic Insert: cellodextrin phosphorylase
Vector Backbone Description: Backbone Size:3464; Vector Backbone:self assembled; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35397553

Proper citation: RRID:Addgene_179276 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X