Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDY0310 TP901-1 Integrase Resource Report Resource Website |
RRID:Addgene_179110 | TP901-1 Integrase | Ampicillin | PMID:36424489 | Please visit https://doi.org/10.1101/2021.11.01.466786 for bioRxiv preprint. | Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:20 | 0 | ||
|
pHN922 Resource Report Resource Website |
RRID:Addgene_178975 | GST-His8-GFP-nanobody | Synthetic | Ampicillin | Backbone Marker:Cytiva; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:20 | 0 | |||
|
GST-FOXO3a WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_1790 | FOXO3a | Homo sapiens | Ampicillin | PMID:10102273 | See author's sequence and map. | Backbone Size:4968; Vector Backbone:pGex 4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:20 | 4 | |
|
pADV-Sec61b-TurboID Resource Report Resource Website |
RRID:Addgene_179143 | Sec61b-V5-TurboID | Synthetic | Kanamycin | PMID:34471136 | Sec61b-V5-TurboID_pcDNA5 is Addgene plasmid # 166971. To generate adenovirus, digest with PacI and perform transfection to HEK293 cells according to Luo et al (PMID:17546019) procedure #14. Please note: The plasmid contains a 1650bp insertion just downstream of the Left Arm compared to the depositor's provided sequence. This difference is not known to affect plasmid function. | Backbone Marker:Tong-Chuan He laboratory; Backbone Size:35725; Vector Backbone:pAdTrack-CMV, pAdEasy-1; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:20 | 0 | |
|
pSYC-201 Resource Report Resource Website |
RRID:Addgene_178963 | Glial fibrillary acidic protein promoter | Danio rerio | Ampicillin | PMID:28882119 | Backbone Size:3323; Vector Backbone:pminiTol2; Vector Types:Tol2 mediated recombination; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:20 | 0 | ||
|
pSYC-204 Resource Report Resource Website |
RRID:Addgene_178964 | Glial fibrillary acidic protein promoter | Danio rerio | Ampicillin | PMID:28882119 | Backbone Size:3323; Vector Backbone:pminiTol2; Vector Types:Tol2 mediated recombination; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:22 | 0 | ||
|
pRDA_426 Resource Report Resource Website 1+ mentions |
RRID:Addgene_179097 | ABE8e | Synthetic | Ampicillin | PMID:35288574 | Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:23 | 3 | ||
|
pRDA_450 Resource Report Resource Website |
RRID:Addgene_179094 | SpRY | Synthetic | Ampicillin | PMID:35288574 | Vector Backbone:pRDA_085; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:23 | 0 | ||
|
pLKO.1 shFEN Resource Report Resource Website |
RRID:Addgene_17921 | shFEN | Homo sapiens | Ampicillin | PMID:18394896 | Target sequence: TCACTAAGCAGCACAATGAT | Backbone Size:7200; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:21 | 0 | |
|
pRDA_336 Resource Report Resource Website 1+ mentions |
RRID:Addgene_179095 | BE3.9 (Cas9-NG) | Synthetic | Ampicillin | PMID:35288574 | Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:20 | 1 | ||
|
pRDA_429 Resource Report Resource Website 1+ mentions |
RRID:Addgene_179098 | ABE8e (Cas9-NG) | Synthetic | Ampicillin | PMID:35288574 | Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:20 | 2 | ||
|
pCAG-mSpata33 (I81A)-PA Resource Report Resource Website |
RRID:Addgene_179131 | spermatogenesis associated 33 | Mus musculus | Ampicillin | PMID:34446558 | Backbone Size:5211; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Isoleucine 81 to Alanine | 2026-08-15 01:11:20 | 0 | |
|
pRDA_479 Resource Report Resource Website 1+ mentions |
RRID:Addgene_179099 | ABE8e (SpG) | Synthetic | Ampicillin | PMID:35288574 | Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:20 | 7 | ||
|
pCAG-mSpata33 (I83A)-PA Resource Report Resource Website |
RRID:Addgene_179132 | spermatogenesis associated 33 | Mus musculus | Ampicillin | PMID:34446558 | Backbone Size:5211; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Isoleucine 83 to Alanine | 2026-08-15 01:11:20 | 0 | |
|
pGEX4T1-WWP1F792D Resource Report Resource Website |
RRID:Addgene_179328 | WWP1 F792D | Homo sapiens | Ampicillin | Best yields for protein purification were found in BL21 (DE) cells using an overnight induction at 16C | Backbone Marker:GEHealthcare; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | F792D mutation; Codon Optimized for expression in E. coli | 2026-08-15 01:11:21 | 0 | |
|
pLB37_PB_pGK-H2B-mIFP-T2A-rTetR-HDAC4-zeo Resource Report Resource Website 1+ mentions |
RRID:Addgene_179440 | H2B-mIFP-T2A-rTetR-HDAC4 | Homo sapiens | Ampicillin | PMID:35678392 | Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint. | Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:22 | 2 | |
|
pLB62_PB_pGK-H2B-mIFP-T2A-rTetR-humanKRAB-zeo Resource Report Resource Website 1+ mentions |
RRID:Addgene_179439 | H2B-mIFP-T2A-rTetR-KRAB | Homo sapiens | Ampicillin | PMID:35678392 | Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint. | Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:22 | 1 | |
|
pET-epELM-5 Resource Report Resource Website |
RRID:Addgene_179391 | ELMSAN1 | Homo sapiens | Kanamycin | PMID:34912035 | The insert encodes the epitope (ELMSAN1 residue 550-600) of the antibody (Catalog # A303-157A, BETHYL). Expressed protein has been confirmed by Western blot. | Backbone Marker:Novagen; Backbone Size:5367; Vector Backbone:pET28C (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:11:21 | 0 | |
|
GFP-LacI-polylinker Resource Report Resource Website |
RRID:Addgene_179271 | Ampicillin | PMID:32984337 | Backbone Marker:Takara; Backbone Size:7304; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:21 | 0 | ||||
|
pPOLY_new Resource Report Resource Website 1+ mentions |
RRID:Addgene_179276 | cellodextrin phosphorylase | Clostridium cellulosi | Ampicillin | PMID:35397553 | Backbone Size:3464; Vector Backbone:self assembled; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:24 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
