Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,326 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pDY0310 TP901-1 Integrase
 
Resource Report
Resource Website
RRID:Addgene_179110 TP901-1 Integrase Ampicillin PMID:36424489 Please visit https://doi.org/10.1101/2021.11.01.466786 for bioRxiv preprint. Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:20 0
pHN922
 
Resource Report
Resource Website
RRID:Addgene_178975 GST-His8-GFP-nanobody Synthetic Ampicillin Backbone Marker:Cytiva; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin 2026-08-15 01:11:20 0
GST-FOXO3a WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_1790 FOXO3a Homo sapiens Ampicillin PMID:10102273 See author's sequence and map. Backbone Size:4968; Vector Backbone:pGex 4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:20 4
pADV-Sec61b-TurboID
 
Resource Report
Resource Website
RRID:Addgene_179143 Sec61b-V5-TurboID Synthetic Kanamycin PMID:34471136 Sec61b-V5-TurboID_pcDNA5 is Addgene plasmid # 166971. To generate adenovirus, digest with PacI and perform transfection to HEK293 cells according to Luo et al (PMID:17546019) procedure #14. Please note: The plasmid contains a 1650bp insertion just downstream of the Left Arm compared to the depositor's provided sequence. This difference is not known to affect plasmid function. Backbone Marker:Tong-Chuan He laboratory; Backbone Size:35725; Vector Backbone:pAdTrack-CMV, pAdEasy-1; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin 2026-08-15 01:11:20 0
pSYC-201
 
Resource Report
Resource Website
RRID:Addgene_178963 Glial fibrillary acidic protein promoter Danio rerio Ampicillin PMID:28882119 Backbone Size:3323; Vector Backbone:pminiTol2; Vector Types:Tol2 mediated recombination; Bacterial Resistance:Ampicillin 2026-08-15 01:11:20 0
pSYC-204
 
Resource Report
Resource Website
RRID:Addgene_178964 Glial fibrillary acidic protein promoter Danio rerio Ampicillin PMID:28882119 Backbone Size:3323; Vector Backbone:pminiTol2; Vector Types:Tol2 mediated recombination; Bacterial Resistance:Ampicillin 2026-08-15 01:11:22 0
pRDA_426
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_179097 ABE8e Synthetic Ampicillin PMID:35288574 Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:23 3
pRDA_450
 
Resource Report
Resource Website
RRID:Addgene_179094 SpRY Synthetic Ampicillin PMID:35288574 Vector Backbone:pRDA_085; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:23 0
pLKO.1 shFEN
 
Resource Report
Resource Website
RRID:Addgene_17921 shFEN Homo sapiens Ampicillin PMID:18394896 Target sequence: TCACTAAGCAGCACAATGAT Backbone Size:7200; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:11:21 0
pRDA_336
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_179095 BE3.9 (Cas9-NG) Synthetic Ampicillin PMID:35288574 Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:20 1
pRDA_429
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_179098 ABE8e (Cas9-NG) Synthetic Ampicillin PMID:35288574 Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:20 2
pCAG-mSpata33 (I81A)-PA
 
Resource Report
Resource Website
RRID:Addgene_179131 spermatogenesis associated 33 Mus musculus Ampicillin PMID:34446558 Backbone Size:5211; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed Isoleucine 81 to Alanine 2026-08-15 01:11:20 0
pRDA_479
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_179099 ABE8e (SpG) Synthetic Ampicillin PMID:35288574 Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:11:20 7
pCAG-mSpata33 (I83A)-PA
 
Resource Report
Resource Website
RRID:Addgene_179132 spermatogenesis associated 33 Mus musculus Ampicillin PMID:34446558 Backbone Size:5211; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed Isoleucine 83 to Alanine 2026-08-15 01:11:20 0
pGEX4T1-WWP1F792D
 
Resource Report
Resource Website
RRID:Addgene_179328 WWP1 F792D Homo sapiens Ampicillin Best yields for protein purification were found in BL21 (DE) cells using an overnight induction at 16C Backbone Marker:GEHealthcare; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin F792D mutation; Codon Optimized for expression in E. coli 2026-08-15 01:11:21 0
pLB37_PB_pGK-H2B-mIFP-T2A-rTetR-HDAC4-zeo
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_179440 H2B-mIFP-T2A-rTetR-HDAC4 Homo sapiens Ampicillin PMID:35678392 Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint. Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:22 2
pLB62_PB_pGK-H2B-mIFP-T2A-rTetR-humanKRAB-zeo
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_179439 H2B-mIFP-T2A-rTetR-KRAB Homo sapiens Ampicillin PMID:35678392 Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint. Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:22 1
pET-epELM-5
 
Resource Report
Resource Website
RRID:Addgene_179391 ELMSAN1 Homo sapiens Kanamycin PMID:34912035 The insert encodes the epitope (ELMSAN1 residue 550-600) of the antibody (Catalog # A303-157A, BETHYL). Expressed protein has been confirmed by Western blot. Backbone Marker:Novagen; Backbone Size:5367; Vector Backbone:pET28C (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:21 0
GFP-LacI-polylinker
 
Resource Report
Resource Website
RRID:Addgene_179271 Ampicillin PMID:32984337 Backbone Marker:Takara; Backbone Size:7304; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:21 0
pPOLY_new
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_179276 cellodextrin phosphorylase Clostridium cellulosi Ampicillin PMID:35397553 Backbone Size:3464; Vector Backbone:self assembled; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:11:24 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.