Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 415 showing 8281 ~ 8300 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_1522

    This resource has 1+ mentions.

http://www.addgene.org/1522

Vector Backbone Description: Backbone Size:9726; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD103.05, Ligation number L2865.

Proper citation: RRID:Addgene_1522 Copy   


  • RRID:Addgene_15227

    This resource has 1+ mentions.

http://www.addgene.org/15227

Species: Mus musculus
Genetic Insert: Neuroligin 1 with insert A
Vector Backbone Description: Backbone Size:4842; Vector Backbone:pCAAGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16846852

Proper citation: RRID:Addgene_15227 Copy   


  • RRID:Addgene_15226

    This resource has 1+ mentions.

http://www.addgene.org/15226

Species: Homo sapiens
Genetic Insert: G protein coupled receptor kinase-interacting protein 1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:PEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11896197

Proper citation: RRID:Addgene_15226 Copy   


  • RRID:Addgene_15223

    This resource has 1+ mentions.

http://www.addgene.org/15223

Species: Homo sapiens
Genetic Insert: G protein coupled receptor kinase-interacting protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6100; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16825424

Proper citation: RRID:Addgene_15223 Copy   


  • RRID:Addgene_152401

    This resource has 1+ mentions.

http://www.addgene.org/152401

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp9
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725305.1

Proper citation: RRID:Addgene_152401 Copy   


  • RRID:Addgene_15239

    This resource has 1+ mentions.

http://www.addgene.org/15239

Species: Homo sapiens
Genetic Insert: Human neuronal kinesin heavy chain
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS SK-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7514426

Proper citation: RRID:Addgene_15239 Copy   


  • RRID:Addgene_152341

    This resource has 1+ mentions.

http://www.addgene.org/152341

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 ORF3a protein
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724391.1

Proper citation: RRID:Addgene_152341 Copy   


  • RRID:Addgene_152527

    This resource has 1+ mentions.

http://www.addgene.org/152527

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 N (nucleocapsid)
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724397.2

Proper citation: RRID:Addgene_152527 Copy   


  • RRID:Addgene_15251

    This resource has 1+ mentions.

http://www.addgene.org/15251

Species: Homo sapiens
Genetic Insert: v-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176

Proper citation: RRID:Addgene_15251 Copy   


  • RRID:Addgene_15250

    This resource has 1+ mentions.

http://www.addgene.org/15250

Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, beta isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: CAACAATTGCCCTAGCACTTG

Proper citation: RRID:Addgene_15250 Copy   


  • RRID:Addgene_152437

    This resource has 1+ mentions.

http://www.addgene.org/152437

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1

Proper citation: RRID:Addgene_152437 Copy   


  • RRID:Addgene_15249

    This resource has 1+ mentions.

http://www.addgene.org/15249

Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, alpha isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: GACAACAGCACCTTGCAGAGT

Proper citation: RRID:Addgene_15249 Copy   


http://www.addgene.org/15264

Species: Homo sapiens
Genetic Insert: IKB alpha
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17574021

Proper citation: RRID:Addgene_15264 Copy   


  • RRID:Addgene_15261

    This resource has 1+ mentions.

http://www.addgene.org/15261

Species: Mus musculus
Genetic Insert: Neuroligin 1 with insert B
Vector Backbone Description: Backbone Size:4921; Vector Backbone:pCAAGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16846852

Proper citation: RRID:Addgene_15261 Copy   


  • RRID:Addgene_15260

    This resource has 10+ mentions.

http://www.addgene.org/15260

Species: Mus musculus
Genetic Insert: Neuroligin 1
Vector Backbone Description: Backbone Size:4921; Vector Backbone:pCAAGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16846852
Comments: There is a A43V mutation in the aa acid sequence. The mutation is within the signal sequence and our data demonstrate that cleavage is normal. That means the mature protein does not have any change in amino acid sequence.

Proper citation: RRID:Addgene_15260 Copy   


  • RRID:Addgene_152594

    This resource has 1+ mentions.

http://www.addgene.org/152594

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 N (nucleocapsid)
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724397.2

Proper citation: RRID:Addgene_152594 Copy   


  • RRID:Addgene_15269

    This resource has 10+ mentions.

http://www.addgene.org/15269

Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17574021

Proper citation: RRID:Addgene_15269 Copy   


  • RRID:Addgene_15290

    This resource has 1+ mentions.

http://www.addgene.org/15290

Species: Homo sapiens
Genetic Insert: inhibitor of Kappa B alpha
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17574021

Proper citation: RRID:Addgene_15290 Copy   


  • RRID:Addgene_153055

    This resource has 1+ mentions.

http://www.addgene.org/153055

Species: Homo sapiens
Genetic Insert: RARS
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Vector Backbone:pNIC-Bio3; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Backbone vector pNIC-Bio3, Genbank acc. no. JN792439

Proper citation: RRID:Addgene_153055 Copy   


http://www.addgene.org/153061

Species: Homo sapiens
Genetic Insert: BHLHE40
Vector Backbone Description: Backbone Size:8871; Vector Backbone:pLVX-EF1α-IRES-ZsGreen1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32205878

Proper citation: RRID:Addgene_153061 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X