Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: USP33
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:0; Vector Backbone:pDEST_Tet_ON_CMV_N_FLAG_HA_PGK_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22601 Copy
Species: Homo sapiens
Genetic Insert: UCHL1
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22563 Copy
Species: Homo sapiens
Genetic Insert: STAMBP
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22560 Copy
Species: Homo sapiens
Genetic Insert: Proteolipid Protein
Vector Backbone Description: Backbone Size:2665; Vector Backbone:pUC8; Vector Types:E. Coli phagemid vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2449540
Comments: The 1300bp Humanc Proteolipid protein (PLP) was subcloned from a lambda gt11 human brainstem cDNA library
This PLP DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22615 Copy
Species: Homo sapiens
Genetic Insert: USP2
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22577 Copy
Species: Homo sapiens
Genetic Insert: OTUD5
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:0; Vector Backbone:pDEST_Tet_ON_CMV_N_FLAG_HA_PGK_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22610 Copy
Species: Homo sapiens
Genetic Insert: USP36
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22579 Copy
Species: Homo sapiens
Genetic Insert: USP18
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22572 Copy
Species: Homo sapiens
Genetic Insert: USP20
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22573 Copy
Species: Homo sapiens
Genetic Insert: USP21
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22574 Copy
Species: Homo sapiens
Genetic Insert: USP15
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22570 Copy
Species: Homo sapiens
Genetic Insert: JOSD1
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22547 Copy
Species: Homo sapiens
Genetic Insert: EIF3S3(1-348aa)
Vector Backbone Description: Backbone Marker:Harper_Lab; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22545 Copy
Species: Homo sapiens
Genetic Insert: COPS5
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22541 Copy
Species: Homo sapiens
Genetic Insert: PARP11
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22556 Copy
Species: Homo sapiens
Genetic Insert: OTUB1
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:MSCV-N-Flag-HA-IRES-PURO; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22551 Copy
Species: Homo sapiens
Genetic Insert: OTUB2
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732
Proper citation: RRID:Addgene_22552 Copy
Species: Homo sapiens
Genetic Insert: Rev Erb alpha
Vector Backbone Description: Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20018698
Proper citation: RRID:Addgene_22745 Copy
Species: Homo sapiens
Genetic Insert: E1A-like inhibitor of differentiation 1
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4938; Vector Backbone:pGex2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11073989
Proper citation: RRID:Addgene_22689 Copy
Species: Homo sapiens
Genetic Insert: miR-31
Vector Backbone Description: Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Useful for stable suppression of miR-31 function.
Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel
Repeated sequence is: AGGCAAGACGAGGCATAGCT
*Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.
Proper citation: RRID:Addgene_22694 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.