Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Flag-HA-USP33
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22601 USP33 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:0; Vector Backbone:pDEST_Tet_ON_CMV_N_FLAG_HA_PGK_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 4
Flag-HA-UCHL1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22563 UCHL1 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 4
Flag-HA-STAMBP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22560 STAMBP Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 2
pPLP1.3
 
Resource Report
Resource Website 		RRID:Addgene_22615 Proteolipid Protein Homo sapiens Ampicillin PMID:2449540 The 1300bp Humanc Proteolipid protein (PLP) was subcloned from a lambda gt11 human brainstem cDNA library This PLP DNA cloned by Hudson lab. Backbone Size:2665; Vector Backbone:pUC8; Vector Types:E. Coli phagemid vector; Bacterial Resistance:Ampicillin 2026-08-15 01:12:13 0
Flag-HA-USP2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22577 USP2 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 4
Flag-HA-OTUD5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22610 OTUD5 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:0; Vector Backbone:pDEST_Tet_ON_CMV_N_FLAG_HA_PGK_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:13 3
Flag-HA-USP36
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22579 USP36 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 5
Flag-HA-USP18
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22572 USP18 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 4
Flag-HA-USP20
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22573 USP20 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 3
Flag-HA-USP21
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22574 USP21 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 5
Flag-HA-USP15
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22570 USP15 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 5
Flag-HA-JOSD1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22547 JOSD1 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:12 2
Flag-HA-EIF3S3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22545 EIF3S3(1-348aa) Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:12 1
Flag-HA-COPS5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22541 COPS5 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:12 3
Flag-HA-PARP11
 
Resource Report
Resource Website 		RRID:Addgene_22556 PARP11 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 0
Flag-HA-OTUB1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22551 OTUB1 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:MSCV-N-Flag-HA-IRES-PURO; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:12 5
Flag-HA-OTUB2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22552 OTUB2 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:13 1
pAdTrack-CMV FLAG Rev-Erb alpha
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22745 Rev Erb alpha Homo sapiens Kanamycin PMID:20018698 Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin 2026-08-15 01:12:15 1
EID1-pGex-2TK
 
Resource Report
Resource Website 		RRID:Addgene_22689 E1A-like inhibitor of differentiation 1 Homo sapiens Ampicillin PMID:11073989 Backbone Marker:Pharmacia; Backbone Size:4938; Vector Backbone:pGex2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin wt cDNA 2026-08-15 01:12:14 0
pBABE-puro-mIR-31 sponge
 
Resource Report
Resource Website 		RRID:Addgene_22694 miR-31 Homo sapiens Ampicillin PMID:19524507 Useful for stable suppression of miR-31 function. Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel Repeated sequence is: AGGCAAGACGAGGCATAGCT *Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning. Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin miR-31 sponge with 7x tandem binding sites to the microRNA. 2026-08-15 01:12:14 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch