Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: jGCaMP7b-XC
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36196992
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.09.475579v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_178361 Copy
Species: Discosoma sp., A. victoria
Genetic Insert: E. coli optimized red flourescent protein (RFPec), GFPuv
Vector Backbone Description: Backbone Marker:Groningen Biotechnology Center; Backbone Size:0; Vector Backbone:pBAD24; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16845378
Proper citation: RRID:Addgene_17827 Copy
Species: Mus musculus
Genetic Insert: pAAV hSyn iGluSnFR3 v857.SGZ
Vector Backbone Description: Backbone Size:4200; Vector Backbone:pAAV hSyn; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767
Proper citation: RRID:Addgene_178330 Copy
Species: Homo sapiens
Genetic Insert: shSHP2
Vector Backbone Description: Backbone Marker:Chen lab; Backbone Size:8200; Vector Backbone:MDH1-404-H2Kb2; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17382377
Comments: Target region of SHP-2: TTGCCCACGCATATCATGTAGT (NM_011202.3: 5421 to 5442, 3’ UTR).
Proper citation: RRID:Addgene_17854 Copy
Species: Homo sapiens
Genetic Insert: NEUROD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34582787
Proper citation: RRID:Addgene_178582 Copy
Species: Mus musculus
Genetic Insert: Stargazin-mEGFP-iLID
Vector Backbone Description: Backbone Size:4720; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34880255
Comments: The sequence and plasmid map is available in the following benchling link (https://benchling.com/s/seq-XUhPNN7CavWnbGAq1TUe).
Proper citation: RRID:Addgene_178523 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12535517
Comments: This clone was generated by my postdoctoral felllow: Xavier Espanel.
Proper citation: RRID:Addgene_17843 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12535517
Comments: This clone was generated by my postdoctoral felllow: Akihiko Komuro.
Proper citation: RRID:Addgene_17844 Copy
Species: Quail
Genetic Insert: TVA950 Glu66→Thr
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV, Cre/Lox, Adeno-associated virus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_178430 Copy
Species: Homo sapiens
Genetic Insert: GGA1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12686608
Comments: Please note: Plasmid contains a S434L mutation in GGA1 compared to the NCBI reference sequence NP_037497.1. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_178459 Copy
Species: Homo sapiens
Genetic Insert: BATF
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35245086
Proper citation: RRID:Addgene_178451 Copy
Species: Homo sapiens
Genetic Insert: STAT2
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35245086
Proper citation: RRID:Addgene_178449 Copy
Species: Other
Genetic Insert: miRE-Ptbp1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34582787
Proper citation: RRID:Addgene_178589 Copy
Species: E. coli
Genetic Insert: FLII12Pglu-700uDelta6
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF/myc/ER; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18177733
Proper citation: RRID:Addgene_17867 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34582787
Proper citation: RRID:Addgene_178583 Copy
Species: Mus musculus
Genetic Insert: NFATc3
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11439183
Comments: Full-length mNFATc3
Proper citation: RRID:Addgene_17868 Copy
Species: Mus musculus
Genetic Insert: CnA alpha
Vector Backbone Description: Backbone Size:3300; Vector Backbone:pBJ5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1377362
Proper citation: RRID:Addgene_17871 Copy
Species: Bos taurus
Genetic Insert: GRK2
Vector Backbone Description: Backbone Size:9173; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35045279
Proper citation: RRID:Addgene_178734 Copy
Species: Homo sapiens
Genetic Insert: Brg
Vector Backbone Description: Backbone Size:3300; Vector Backbone:pBJ5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8232556
Comments: This plasmid is an expression vector for the full length BRG/BAF190 protein which is similar to Drosphila Brm and contains the conserved ATPase domain in the yeast SWI2/SNF2 protein.
Addgene QC NGS analysis identifies an R1608Q mutation relative to NP_001122316.1.
Proper citation: RRID:Addgene_17873 Copy
Species: Homo sapiens
Genetic Insert: BAF155
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript SK-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8804307
Comments: Full-length human BAF155. See Author's map for more information.
Proper citation: RRID:Addgene_17876 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.