Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: pCSacB
Vector Backbone Description: Vector Backbone:pCSacB; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26222032
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_69344 Copy
Genetic Insert: sU6 promoter and sgRNA scaffold flanked by BbsI sites
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:Topo Blunt II; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26278926
Proper citation: RRID:Addgene_69351 Copy
Genetic Insert: mU6 promoter and sgRNA scaffold flanked by BbsI sites
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:Topo Blunt II; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26278926
Proper citation: RRID:Addgene_69350 Copy
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pTET; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26283792
Proper citation: RRID:Addgene_69529 Copy
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pTET; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26283792
Proper citation: RRID:Addgene_69528 Copy
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pTKW106; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26019220
Comments: Addgene's NGS results identified sequence discrepancies relative to the depositor's approximate sequence provided in the annotated GenBank file. These discrepancies are not believed to impact the function of the plasmid.
Proper citation: RRID:Addgene_69360 Copy
Genetic Insert: PduD from Salmonella
Vector Backbone Description: Vector Backbone:pTET; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26283792
Proper citation: RRID:Addgene_69525 Copy
Species: Other
Genetic Insert: Super folder GFP
Vector Backbone Description: Backbone Size:1763; Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29572528
Proper citation: RRID:Addgene_69496 Copy
Species: Synthetic
Genetic Insert: CFPint-FgF
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19259264
Proper citation: RRID:Addgene_69318 Copy
Species: Synthetic
Genetic Insert: YFPint-FgF
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19259264
Proper citation: RRID:Addgene_69317 Copy
Species: Synthetic
Genetic Insert: GFPint-FgF
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19259264
Proper citation: RRID:Addgene_69316 Copy
Species: Synthetic
Genetic Insert: Venus-FgF
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19259264
Proper citation: RRID:Addgene_69321 Copy
Species: Synthetic
Genetic Insert: gSL2-NLS-mChOint-FgF
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19259264
Proper citation: RRID:Addgene_69328 Copy
Species: Synthetic
Genetic Insert: gSL2-NLS-GFPint-FgF
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19259264
Proper citation: RRID:Addgene_69324 Copy
Species: Transposon Tn5
Genetic Insert: aphII
Vector Backbone Description: Backbone Size:2140; Vector Backbone:pSG5; Vector Types:Bacterial Expression, Streptomyces- E. coli shuttle vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16776656
Comments: Stable replicating, multi copy shuttle vector for thiostrepton induced gene expression in Streptomyces
temperature sensitive replication (G. Muth, B. Nußbaumer, W. Wohlleben and A. Pühler (1989) A vector system with temperature-sensitive replication for gene disruption and mutational cloning in streptomycetes. Mol. Gen. Genet. 219, 341-348 )
http://www.uni-tuebingen.de/en/faculties/faculty-of-science/departments/inter-faculty-institutes-and-centres/imit/units/mikrobiologiebiotechnologie/work-groups/muth/plasmids.html
Proper citation: RRID:Addgene_69614 Copy
Species: Synthetic
Genetic Insert: cp173Venus-Ggamma2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26799488
Proper citation: RRID:Addgene_69626 Copy
Species: Synthetic
Genetic Insert: Gbeta-2A-cpV-Ggamma2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:Clontech-style N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26799488
Proper citation: RRID:Addgene_69625 Copy
Species: Mus musculus
Genetic Insert: mSTIM1_1-250
Vector Backbone Description: Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26184105
Proper citation: RRID:Addgene_69552 Copy
Species: Mus musculus
Genetic Insert: mSTIM1_1-310
Vector Backbone Description: Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26184105
Proper citation: RRID:Addgene_69551 Copy
Species: Mus musculus
Genetic Insert: Runx1 +23 intronic enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pENTR attL4-R1; Vector Types:5' Gateway Entry Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25594182
Comments: All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol.
1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883
2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343
Proper citation: RRID:Addgene_69602 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.