Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEGFP-N1-jGCaMP7b-XC Resource Report Resource Website 1+ mentions |
RRID:Addgene_178361 | jGCaMP7b-XC | Synthetic | Kanamycin | PMID:36196992 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.09.475579v1 for bioRxiv preprint. | Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:01:05 | 1 | |
|
p70rg Resource Report Resource Website 1+ mentions |
RRID:Addgene_17827 | E. coli optimized red flourescent protein (RFPec), GFPuv | Discosoma sp., A. victoria | Ampicillin | PMID:16845378 | Backbone Marker:Groningen Biotechnology Center; Backbone Size:0; Vector Backbone:pBAD24; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:05 | 1 | ||
|
pAAV.hSyn.iGluSnFR3.v857.SGZ Resource Report Resource Website 1+ mentions |
RRID:Addgene_178330 | pAAV hSyn iGluSnFR3 v857.SGZ | Mus musculus | Ampicillin | PMID:37142767 | Backbone Size:4200; Vector Backbone:pAAV hSyn; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:05 | 4 | ||
|
MDH1-shSHP2-3-H2Kb2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17854 | shSHP2 | Homo sapiens | Ampicillin | PMID:17382377 | Target region of SHP-2: TTGCCCACGCATATCATGTAGT (NM_011202.3: 5421 to 5442, 3’ UTR). | Backbone Marker:Chen lab; Backbone Size:8200; Vector Backbone:MDH1-404-H2Kb2; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:07 | 1 | |
|
AAV-hGFAP-NEUROD1-T2A-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_178582 | NEUROD1 | Homo sapiens | Ampicillin | PMID:34582787 | Backbone Size:4700; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:07 | 2 | ||
|
pCAGGS-Stargazin-mEGFP-iLID Resource Report Resource Website 1+ mentions |
RRID:Addgene_178523 | Stargazin-mEGFP-iLID | Mus musculus | Ampicillin | PMID:34880255 | The sequence and plasmid map is available in the following benchling link (https://benchling.com/s/seq-XUhPNN7CavWnbGAq1TUe). | Backbone Size:4720; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:07 | 1 | |
|
pEGFP-C3-hYAP1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_17843 | YAP | Homo sapiens | Kanamycin | PMID:12535517 | This clone was generated by my postdoctoral felllow: Xavier Espanel. | Backbone Marker:CLONTECH; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:01:06 | 37 | |
|
pEGFP-C3-hYAP2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17844 | YAP | Homo sapiens | Kanamycin | PMID:12535517 | This clone was generated by my postdoctoral felllow: Akihiko Komuro. | Backbone Marker:CLONTECH; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:01:06 | 1 | |
|
AAV-DIO-TC66T-2A-oG Resource Report Resource Website 1+ mentions |
RRID:Addgene_178430 | TVA950 Glu66→Thr | Quail | Ampicillin | Vector Backbone:pAAV; Vector Types:AAV, Cre/Lox, Adeno-associated virus; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:06 | 1 | |||
|
GFP-GGA1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_178459 | GGA1 | Homo sapiens | Kanamycin | PMID:12686608 | Please note: Plasmid contains a S434L mutation in GGA1 compared to the NCBI reference sequence NP_037497.1. This mutation is not known to affect plasmid function. | Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | See Depositor Comments Below | 2026-08-29 01:01:06 | 1 |
|
pFUW-TetO-BATF Resource Report Resource Website 1+ mentions |
RRID:Addgene_178451 | BATF | Homo sapiens | Ampicillin | PMID:35245086 | Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:06 | 1 | ||
|
pFUW-TetO-STAT2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_178449 | STAT2 | Homo sapiens | Ampicillin | PMID:35245086 | Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:06 | 1 | ||
|
AAV-hGFAP-mCherry-shPtbp1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_178589 | miRE-Ptbp1 | Other | Ampicillin | PMID:34582787 | Backbone Size:4700; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:08 | 1 | ||
|
pEF/myc/ER FLII12Pglu-700uDelta6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17867 | FLII12Pglu-700uDelta6 | E. coli | Ampicillin | PMID:18177733 | Backbone Size:0; Vector Backbone:pEF/myc/ER; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 700uDelta6, ECFP insert in mglB | 2026-08-29 01:01:08 | 2 | |
|
AAV-CAG-FLEX-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_178583 | mCherry | Other | Ampicillin | PMID:34582787 | Backbone Size:5000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:08 | 2 | ||
|
pBS mNFATc3-EE Resource Report Resource Website 1+ mentions |
RRID:Addgene_17868 | NFATc3 | Mus musculus | Ampicillin | PMID:11439183 | Full-length mNFATc3 | Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:08 | 2 | |
|
pBJ5 mCnA alpha Resource Report Resource Website 1+ mentions |
RRID:Addgene_17871 | CnA alpha | Mus musculus | Ampicillin | PMID:1377362 | Backbone Size:3300; Vector Backbone:pBJ5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:08 | 1 | ||
|
myristoylated ct-GRK2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_178734 | GRK2 | Bos taurus | Ampicillin | PMID:35045279 | Backbone Size:9173; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | only amino acids 548-671 | 2026-08-29 01:01:08 | 1 | |
|
pBJ5 hBRG1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17873 | Brg | Homo sapiens | Ampicillin | PMID:8232556 | This plasmid is an expression vector for the full length BRG/BAF190 protein which is similar to Drosphila Brm and contains the conserved ATPase domain in the yeast SWI2/SNF2 protein. Addgene QC NGS analysis identifies an R1608Q mutation relative to NP_001122316.1. | Backbone Size:3300; Vector Backbone:pBJ5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R1608Q | 2026-08-29 01:01:08 | 6 |
|
pBS hBAF155 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17876 | BAF155 | Homo sapiens | Ampicillin | PMID:8804307 | Full-length human BAF155. See Author's map for more information. | Backbone Size:3000; Vector Backbone:pBluescript SK-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:09 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
