Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pRR-ERbeta-5Z Resource Report Resource Website |
RRID:Addgene_23062 | ERbeta | Homo sapiens | Ampicillin | PMID:19962400 | Backbone Marker:PMID: 8800671; Backbone Size:8700; Vector Backbone:pRW95-3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:18 | 0 | ||
|
pAAV-hPDGFRA-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_22919 | human platelet derived growth factor receptor alpha polypeptide promoter driving GFP | Homo sapiens | Ampicillin | PMID:19949461 | Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:16 | 2 | ||
|
pcDNA FLAG TORC3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22976 | TORC3 | Homo sapiens | Ampicillin | PMID:15454081 | Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:17 | 2 | ||
|
pcDNA FLAG TORC1 (1-630) Resource Report Resource Website 1+ mentions |
RRID:Addgene_22974 | TORC1 (1-630) | Homo sapiens | Ampicillin | PMID:14536081 | There is an XbaI site at the 3' end instead of a NotI site. | Backbone Size:5446; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Amino acids 1-630 rather than 1-634. | 2026-08-15 01:12:16 | 1 |
|
Myc tag WT PTB Resource Report Resource Website 1+ mentions |
RRID:Addgene_23024 | PTB1 | Homo sapiens | Ampicillin | PMID:12851456 | Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:17 | 3 | ||
|
pLenti6/V5-p53_wt p53 Resource Report Resource Website 10+ mentions |
RRID:Addgene_22945 | tumor protein 53 | Homo sapiens | Ampicillin | PMID:18472962 | Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:16 | 23 | ||
|
pHR'CMVGFP_hRIF1(406-2446)IREShygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_23135 | RIF1 deletion construct | Homo sapiens | Ampicillin | PMID:15583028 | Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence. | Backbone Marker:Didier Trono Lab; Backbone Size:10000; Vector Backbone:pHR'CMVGFPIREShygro_WSIN18; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:18 | 4 | |
|
pSIF-H1-hpolb-copGFP Resource Report Resource Website |
RRID:Addgene_23256 | DNA polymerase beta shRNA | Homo sapiens | Ampicillin | PMID:20068071 | shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt | Backbone Marker:SIB; Backbone Size:6400; Vector Backbone:pSIF-H1-copGFP; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:18 | 0 | |
|
B23(9-122) Resource Report Resource Website 1+ mentions |
RRID:Addgene_23142 | B23 core | Homo sapiens | Ampicillin | PMID:17879352 | Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | deleted amino acids 1-8 | 2026-08-15 01:12:18 | 2 | |
|
pFastBac1-Flag-Timeless Resource Report Resource Website |
RRID:Addgene_23119 | Timeless | Homo sapiens | Ampicillin | PMID:20233725 | Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:18 | 0 | ||
|
pcDNA3-Flag-Tipin-E190A Resource Report Resource Website |
RRID:Addgene_23115 | Tipin | Homo sapiens | Ampicillin | PMID:20233725 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed Glutamate 190 to Alanine | 2026-08-15 01:12:18 | 0 | |
|
pcDNA3-Flag-Tipin-E185A Resource Report Resource Website |
RRID:Addgene_23114 | Tipin | Homo sapiens | Ampicillin | PMID:20233725 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed Glutamate 185 to Alanine | 2026-08-15 01:12:18 | 0 | |
|
pLM-mCherry-Klf4 Resource Report Resource Website 10+ mentions |
RRID:Addgene_23243 | mCherry_2A_KLF4 | Homo sapiens | Ampicillin | PMID:19549847 | Backbone Size:6655; Vector Backbone:N/A; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:18 | 10 | ||
|
pET21b-Tipin-His-L195A Resource Report Resource Website |
RRID:Addgene_23123 | Tipin | Homo sapiens | Ampicillin | PMID:20233725 | Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Changed Leucine 195 to Alanine | 2026-08-15 01:12:18 | 0 | |
|
pLM-mCerulean-cMyc Resource Report Resource Website 1+ mentions |
RRID:Addgene_23244 | mCerulean-2A-MYC | Homo sapiens | Ampicillin | PMID:19549847 | There are some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequenced. These differences are not known to affect function. | Backbone Size:6655; Vector Backbone:N/A; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:19 | 7 | |
|
pFastBac-His-Flag-Tipin-L195A Resource Report Resource Website |
RRID:Addgene_23120 | Tipin | Homo sapiens | Ampicillin | PMID:20233725 | Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Changed Leucine 195 to Alanine | 2026-08-15 01:12:18 | 0 | |
|
pFastBac-His-Tipin-L195A Resource Report Resource Website |
RRID:Addgene_23121 | Tipin | Homo sapiens | Ampicillin | PMID:20233725 | Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Changed Leucine 195 to Alanine | 2026-08-15 01:12:18 | 0 | |
|
pDONR223-NEK5 Resource Report Resource Website |
RRID:Addgene_23434 | NEK5 | Homo sapiens | Spectinomycin | PMID:21107320 | The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. | Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | 2026-08-15 01:12:20 | 0 | |
|
pDONR223-TSSK2 Resource Report Resource Website |
RRID:Addgene_23397 | TSSK2 | Homo sapiens | Spectinomycin | PMID:21107320 | The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. | Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | 1MM | 2026-08-15 01:12:19 | 0 |
|
pDONR223-MPP3 Resource Report Resource Website |
RRID:Addgene_23431 | MPP3 | Homo sapiens | Spectinomycin | PMID:21107320 | The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. | Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | 2026-08-15 01:12:20 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.