Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pRR-ERbeta-5Z
 
Resource Report
Resource Website 		RRID:Addgene_23062 ERbeta Homo sapiens Ampicillin PMID:19962400 Backbone Marker:PMID: 8800671; Backbone Size:8700; Vector Backbone:pRW95-3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:18 0
pAAV-hPDGFRA-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22919 human platelet derived growth factor receptor alpha polypeptide promoter driving GFP Homo sapiens Ampicillin PMID:19949461 Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:12:16 2
pcDNA FLAG TORC3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22976 TORC3 Homo sapiens Ampicillin PMID:15454081 Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:17 2
pcDNA FLAG TORC1 (1-630)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22974 TORC1 (1-630) Homo sapiens Ampicillin PMID:14536081 There is an XbaI site at the 3' end instead of a NotI site. Backbone Size:5446; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Amino acids 1-630 rather than 1-634. 2026-08-15 01:12:16 1
Myc tag WT PTB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23024 PTB1 Homo sapiens Ampicillin PMID:12851456 Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:17 3
pLenti6/V5-p53_wt p53
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22945 tumor protein 53 Homo sapiens Ampicillin PMID:18472962 Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:16 23
pHR'CMVGFP_hRIF1(406-2446)IREShygro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23135 RIF1 deletion construct Homo sapiens Ampicillin PMID:15583028 Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence. Backbone Marker:Didier Trono Lab; Backbone Size:10000; Vector Backbone:pHR'CMVGFPIREShygro_WSIN18; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:18 4
pSIF-H1-hpolb-copGFP
 
Resource Report
Resource Website 		RRID:Addgene_23256 DNA polymerase beta shRNA Homo sapiens Ampicillin PMID:20068071 shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt Backbone Marker:SIB; Backbone Size:6400; Vector Backbone:pSIF-H1-copGFP; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:18 0
B23(9-122)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23142 B23 core Homo sapiens Ampicillin PMID:17879352 Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-8 2026-08-15 01:12:18 2
pFastBac1-Flag-Timeless
 
Resource Report
Resource Website 		RRID:Addgene_23119 Timeless Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:18 0
pcDNA3-Flag-Tipin-E190A
 
Resource Report
Resource Website 		RRID:Addgene_23115 Tipin Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed Glutamate 190 to Alanine 2026-08-15 01:12:18 0
pcDNA3-Flag-Tipin-E185A
 
Resource Report
Resource Website 		RRID:Addgene_23114 Tipin Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed Glutamate 185 to Alanine 2026-08-15 01:12:18 0
pLM-mCherry-Klf4
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_23243 mCherry_2A_KLF4 Homo sapiens Ampicillin PMID:19549847 Backbone Size:6655; Vector Backbone:N/A; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:18 10
pET21b-Tipin-His-L195A
 
Resource Report
Resource Website 		RRID:Addgene_23123 Tipin Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Changed Leucine 195 to Alanine 2026-08-15 01:12:18 0
pLM-mCerulean-cMyc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23244 mCerulean-2A-MYC Homo sapiens Ampicillin PMID:19549847 There are some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequenced. These differences are not known to affect function. Backbone Size:6655; Vector Backbone:N/A; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:19 7
pFastBac-His-Flag-Tipin-L195A
 
Resource Report
Resource Website 		RRID:Addgene_23120 Tipin Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Changed Leucine 195 to Alanine 2026-08-15 01:12:18 0
pFastBac-His-Tipin-L195A
 
Resource Report
Resource Website 		RRID:Addgene_23121 Tipin Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Changed Leucine 195 to Alanine 2026-08-15 01:12:18 0
pDONR223-NEK5
 
Resource Report
Resource Website 		RRID:Addgene_23434 NEK5 Homo sapiens Spectinomycin PMID:21107320 The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin 2026-08-15 01:12:20 0
pDONR223-TSSK2
 
Resource Report
Resource Website 		RRID:Addgene_23397 TSSK2 Homo sapiens Spectinomycin PMID:21107320 The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin 1MM 2026-08-15 01:12:19 0
pDONR223-MPP3
 
Resource Report
Resource Website 		RRID:Addgene_23431 MPP3 Homo sapiens Spectinomycin PMID:21107320 The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin 2026-08-15 01:12:20 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch