Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Egg laying Nine - 2 (EglN2)
Vector Backbone Description: Backbone Size:5145; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19878873
Proper citation: RRID:Addgene_22705 Copy
Species: Homo sapiens
Genetic Insert: cyclin D1
Vector Backbone Description: Backbone Size:5536; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19878873
Proper citation: RRID:Addgene_22703 Copy
Species: Homo sapiens
Genetic Insert: Telomere Maintenance 2
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pLPC-N MYC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160036
Proper citation: RRID:Addgene_22802 Copy
Species: Homo sapiens
Genetic Insert: Tipin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17296725
Proper citation: RRID:Addgene_22891 Copy
Species: Homo sapiens
Genetic Insert: human nuclear receptor subfamily 2 group F member 2 promoter driving DsRedExpress
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19949461
Proper citation: RRID:Addgene_22926 Copy
Species: Homo sapiens
Genetic Insert: human c-type natruiretic peptide precursor promoter driving DsRedExpress
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19949461
Proper citation: RRID:Addgene_22921 Copy
Species: Homo sapiens
Genetic Insert: human adrenomedullin promoter driving DsRedExpress
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19949461
Proper citation: RRID:Addgene_22922 Copy
Species: Homo sapiens
Genetic Insert: human type 2 lactosamine alpha-2,3-sialyltransferase promoter driving DsRedExpress
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19949461
Proper citation: RRID:Addgene_22923 Copy
Species: Homo sapiens
Genetic Insert: human receptor metabotropic 1 promoter driving DsRedExpress
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19949461
Proper citation: RRID:Addgene_22920 Copy
Species: Homo sapiens
Genetic Insert: Optineurin
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pDEST17; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17702576
Proper citation: RRID:Addgene_23055 Copy
Species: Homo sapiens
Genetic Insert: GR
Vector Backbone Description: Backbone Marker:PMID: 8800671; Backbone Size:8700; Vector Backbone:pRW95-3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19962400
Proper citation: RRID:Addgene_23060 Copy
Species: Homo sapiens
Genetic Insert: ERbeta
Vector Backbone Description: Backbone Marker:PMID: 8800671; Backbone Size:8700; Vector Backbone:pRW95-3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19962400
Proper citation: RRID:Addgene_23062 Copy
Species: Homo sapiens
Genetic Insert: human platelet derived growth factor receptor alpha polypeptide promoter driving GFP
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19949461
Proper citation: RRID:Addgene_22919 Copy
Species: Homo sapiens
Genetic Insert: TORC3
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15454081
Proper citation: RRID:Addgene_22976 Copy
Species: Homo sapiens
Genetic Insert: TORC1 (1-630)
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14536081
Comments: There is an XbaI site at the 3' end instead of a NotI site.
Proper citation: RRID:Addgene_22974 Copy
Species: Homo sapiens
Genetic Insert: PTB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12851456
Proper citation: RRID:Addgene_23024 Copy
Species: Homo sapiens
Genetic Insert: tumor protein 53
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18472962
Proper citation: RRID:Addgene_22945 Copy
Species: Homo sapiens
Genetic Insert: RIF1 deletion construct
Vector Backbone Description: Backbone Marker:Didier Trono Lab; Backbone Size:10000; Vector Backbone:pHR'CMVGFPIREShygro_WSIN18; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15583028
Comments: Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence.
Proper citation: RRID:Addgene_23135 Copy
Species: Homo sapiens
Genetic Insert: DNA polymerase beta shRNA
Vector Backbone Description: Backbone Marker:SIB; Backbone Size:6400; Vector Backbone:pSIF-H1-copGFP; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20068071
Comments: shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt
Proper citation: RRID:Addgene_23256 Copy
Species: Homo sapiens
Genetic Insert: B23 core
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17879352
Proper citation: RRID:Addgene_23142 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
