Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Depdc5
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46327 Copy
Species: Gallus gallus
Genetic Insert: ECFP + Vcl 1-419
Vector Backbone Description: Backbone Marker:Craig lab; Vector Backbone:pmCitrine-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17074767
Comments: Citrine proved to be a more stable FP in vivo than YFP; CIT was used to make a second generation vinculin FRET probe (first generation control is Addgene plasmid 46277).
Proper citation: RRID:Addgene_46283 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-1066
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pECFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15883197
Comments: A206K was introduced into pECFP-N3/V1-1066 by QC to generate pmECFP/V1066 (vinculin-monomeric ECFP)
Proper citation: RRID:Addgene_46280 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-1066
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15883197
Proper citation: RRID:Addgene_46281 Copy
Species: Homo sapiens
Genetic Insert: SFPQ
Vector Backbone Description: Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Comments: There is a stop codon before HIS tag in the vector.
Proper citation: RRID:Addgene_46320 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-1066
Vector Backbone Description: Backbone Marker:described in N. Kioka. 1999. JCB 144:59-69; Vector Backbone:p401F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46284 Copy
Genetic Insert: 5 copies of A9 sequence from Ihh promoter
Vector Backbone Description: Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19906842
Comments: Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene.
Proper citation: RRID:Addgene_46318 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-1066
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15883197
Proper citation: RRID:Addgene_46279 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.
More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290
Proper citation: RRID:Addgene_46312 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.
More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290
Proper citation: RRID:Addgene_46310 Copy
Species: Homo sapiens
Genetic Insert: HeLa long myosin light chain kinase
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15020676
Proper citation: RRID:Addgene_46316 Copy
Species: Homo sapiens
Genetic Insert: HeLa long myosin light chain kinase-dead
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15020676
Proper citation: RRID:Addgene_46317 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.
More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290
Proper citation: RRID:Addgene_46314 Copy
Species: Mus musculus
Genetic Insert: Vimentin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19726676
Proper citation: RRID:Addgene_46315 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-258 (aka VD1) A50I mutation
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: A50I mutation introduced into EGFP/V1-258 (Addgene plasmid 46270) by QCPCR.
Proper citation: RRID:Addgene_46271 Copy
Species: Gallus gallus
Genetic Insert: Vcl 884-1066 (Vt)
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: PstI-ApaI fragment of pGEX3TV884-1066 subcloned into Pst-Apa cut pEGFP-C3)EGFP.
Proper citation: RRID:Addgene_46272 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-258 (aka VD1)
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: Nde-Xho fragment from pET15b/Vh1-258 (Addgene plasmid 46173) was subcloned into EGFP/V1-1066 (Addgene plasmid 46265) vector modified to contain unique Nde, Xho sites. Modifications were made by QuikChange PCR to facilitate cloning of cDNAs previously in the pET15b vector. The NdeI site present in the cytomegalovirus promoter region was removed (mutating adenine 234 to thymine), and
a new NdeI site was introduced into the multiple cloning site immediately before the vinculin start codon. Additionally, the 5-XhoI site was removed (mutating cytosine 1345 to adenine), and a 3-XhoI site was introduced 3' to the vinculin cDNA in lieu of a PstI site.
Proper citation: RRID:Addgene_46270 Copy
Species: Homo sapiens
Genetic Insert: RepoMan
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:mcherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16492807
Proper citation: RRID:Addgene_46274 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-851 A50I mutation
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: A50I mutation introduced into EGFP/V1-851 (Addgene plasmid 46268) by QCPCR mutation.
Proper citation: RRID:Addgene_46269 Copy
Species: Gallus gallus
Genetic Insert: Vcl T12 mutant
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15728584
Comments: T12 mutation introduced by QuikChange PCR to Addgene plasmid 46265.
Mutant inhibits vinculin autoinhibition by ~ 100 fold, vinculin is partially activated and will bind talin, but not actin (unless both talin and actin are present at same time).
Proper citation: RRID:Addgene_46266 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
