Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: NLS-2xMCP-2xTagRFP-T
Vector Backbone Description: Vector Backbone:pHsp83; Vector Types:Insect Expression, P element-mediated germline transformation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25792328
Proper citation: RRID:Addgene_71242 Copy
Species: Other
Genetic Insert: loxP-hyg-cat-loxP
Vector Backbone Description: Backbone Marker:Jeffery Murry - Eric Rubin Lab; Vector Backbone:pJM1; Vector Types:Bacterial Expression, Source of loxP-hyg-cat- loxP for PCR amplification.; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25779316
Comments: This vector contains a hyg-cat cassette, flanked by loxP sites, that can be used for the construction of recombineeng substrates for M. smegmatis or M. tuberculosis. It contains a 1 bp change (relative to starting plasmid pJM1) at position 2008 (G to C) that eliminate a potential stop codon that could interfere with expression of downstream functions following excision of the cassette from the chromosome by Cre recombinase.
The hygromycin resistance gene encodes M13I and I111T variants compared to the NCBI reference [ADL66925.1]. These variants should not interfere with function.
Proper citation: RRID:Addgene_71487 Copy
Species: Other
Genetic Insert: 2x-mCherry
Vector Backbone Description: Backbone Size:4821; Vector Backbone:pKAN; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26694838
Proper citation: RRID:Addgene_72236 Copy
Species: Other
Genetic Insert: KlURA3
Vector Backbone Description: Vector Backbone:pFA6aKlURA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15260239
Comments: The Resnik and Storici Labs recommend reading the following review articles for more information on this plasmid:
- Storici and Resnick Method Enzymol 2006 PMID: 16793410
- Stuckey et al., Meth. Mol. Biol. 2011 PMID: 21660695
- Stuckey and Storici Methods Enzymol 2013 PMID: 24182920
Proper citation: RRID:Addgene_72238 Copy
Species: Other
Genetic Insert: iCre-P2A-tdTomato-T2A-Puro
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:6677; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_72255 Copy
Species: Other
Genetic Insert: FLPe-P2A-copGFp-T2A-Puro
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:6677; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_72258 Copy
Species: Other
Genetic Insert: copGFP-T2A-iCre
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:6677; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_72256 Copy
Species: Other
Genetic Insert: copGFP-T2A-Puro
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_72263 Copy
Species: Other
Genetic Insert: mCherry-T2A-Puro
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:6227; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_72264 Copy
Species: Other
Genetic Insert: mIFP T2A HO1 IRES EGFP
Vector Backbone Description: Vector Backbone:pLentiCMV dest#2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26098020
Proper citation: RRID:Addgene_72443 Copy
Species: Other
Genetic Insert: mCherry-puromycin cassetter
Vector Backbone Description: Backbone Marker:Rudolf Jaenisch (Addgene plasmid # 22075); Backbone Size:6602; Vector Backbone:AAVS1 SA-2A-puro-pA donor; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23900226
Comments: Plasmid contains left and right homology arms for mouse GDF8 flanking the mCherry-puromycin cassette. ccdB gene is nonfunctional.
Proper citation: RRID:Addgene_72596 Copy
Species: Other
Genetic Insert: CMV-LacZ
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:32705; Vector Backbone:pAdenoX; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_73345 Copy
Species: Other
Genetic Insert: CMV-copGFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:32705; Vector Backbone:pAdenoX; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_73346 Copy
Species: Other
Genetic Insert: shRNA to Luciferase
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:pSIREN RetroQ; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28969075
Proper citation: RRID:Addgene_73666 Copy
Species: Other
Genetic Insert: 2xNLS-mCherry + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73725 Copy
Species: Other
Genetic Insert: mCherry + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73724 Copy
Species: Other
Genetic Insert: tagRFP + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73723 Copy
Species: Other
Genetic Insert: syntron embedded C-terminal FLP-on
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73728 Copy
Species: Other
Genetic Insert: Unc-32::GFP(Cbr-unc-119)
Vector Backbone Description: Vector Backbone:pMLS256; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Comments: 2nd Insert: pU6::Unc-32 sgRNA; oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC
Proper citation: RRID:Addgene_73719 Copy
Species: Other
Genetic Insert: SapI repair template insertion site
Vector Backbone Description: Backbone Marker:Agilent Technologies; Vector Backbone:pBluescript II; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73716 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
