Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
HA Depdc5 pRK5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46327 | Depdc5 | Homo sapiens | Ampicillin | PMID:23723238 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Differs from Depdc5 isoform 1 by 10 amino acids starting at position 724: ILTLSAPPVV | 2026-08-15 01:15:30 | 3 | |
|
pmCIT-CFPGgVcl 1-419 control 2 FRET Resource Report Resource Website |
RRID:Addgene_46283 | ECFP + Vcl 1-419 | Gallus gallus | Kanamycin | PMID:17074767 | Citrine proved to be a more stable FP in vivo than YFP; CIT was used to make a second generation vinculin FRET probe (first generation control is Addgene plasmid 46277). | Backbone Marker:Craig lab; Vector Backbone:pmCitrine-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | aa 1-419 | 2026-08-15 01:15:30 | 0 |
|
pmECFPN3/GgVcl 1-1066 (CFP at C term) Resource Report Resource Website |
RRID:Addgene_46280 | Vcl 1-1066 | Gallus gallus | Kanamycin | PMID:15883197 | A206K was introduced into pECFP-N3/V1-1066 by QC to generate pmECFP/V1066 (vinculin-monomeric ECFP) | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pECFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 0 | |
|
pmECFPC1/GgVcl 1-1066 (CFP at N term) Resource Report Resource Website |
RRID:Addgene_46281 | Vcl 1-1066 | Gallus gallus | Kanamycin | PMID:15883197 | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 0 | ||
|
pSCT-GAL93-SFPQ Resource Report Resource Website 1+ mentions |
RRID:Addgene_46320 | SFPQ | Homo sapiens | Ampicillin | PMID:22966205 | There is a stop codon before HIS tag in the vector. | Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 1 | |
|
p401F/GgVcl 1-1066 (N term FLAG tag) Resource Report Resource Website |
RRID:Addgene_46284 | Vcl 1-1066 | Gallus gallus | Ampicillin | Backbone Marker:described in N. Kioka. 1999. JCB 144:59-69; Vector Backbone:p401F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |||
|
pIhh-5A9-LUC Resource Report Resource Website |
RRID:Addgene_46318 | 5 copies of A9 sequence from Ihh promoter | Ampicillin | PMID:19906842 | Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene. | Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | ||
|
pEYFPC1/GgVcl 1-1066 (YFP at N term) Resource Report Resource Website |
RRID:Addgene_46279 | Vcl 1-1066 | Gallus gallus | Kanamycin | PMID:15883197 | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 0 | ||
|
pGEX-4T-1-p19-T7-PLK1 Resource Report Resource Website |
RRID:Addgene_46312 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
pGEX-4T-1-p19-T7-EGFPFL Resource Report Resource Website |
RRID:Addgene_46310 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
HeLa full-length MLCK-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46316 | HeLa long myosin light chain kinase | Homo sapiens | Kanamycin | PMID:15020676 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 2 | ||
|
Hela kinase-dead MLCK-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46317 | HeLa long myosin light chain kinase-dead | Homo sapiens | Kanamycin | PMID:15020676 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | E1626K | 2026-08-15 01:15:30 | 3 | |
|
pGEX-4T-1-p19-T7-GagB500 Resource Report Resource Website |
RRID:Addgene_46314 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
HA-Vim Resource Report Resource Website 1+ mentions |
RRID:Addgene_46315 | Vimentin | Mus musculus | Ampicillin | PMID:19726676 | Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 1 | ||
|
pEGFPC1/GgVcl 1-258 A50I mutation Resource Report Resource Website 1+ mentions |
RRID:Addgene_46271 | Vcl 1-258 (aka VD1) A50I mutation | Gallus gallus | Kanamycin | PMID:16608855 | A50I mutation introduced into EGFP/V1-258 (Addgene plasmid 46270) by QCPCR. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 1-258 (VD1 domain) A50I mutation | 2026-08-15 01:15:30 | 1 |
|
pEGFPC3/GgVcl 884-1066 (Vt) Resource Report Resource Website |
RRID:Addgene_46272 | Vcl 884-1066 (Vt) | Gallus gallus | Kanamycin | PstI-ApaI fragment of pGEX3TV884-1066 subcloned into Pst-Apa cut pEGFP-C3)EGFP. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 884-1066 (Vt) tail domain | 2026-08-15 01:15:30 | 0 | |
|
pEGFPC1/GgVcl 1-258 (aka VD1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_46270 | Vcl 1-258 (aka VD1) | Gallus gallus | Kanamycin | PMID:16608855 | Nde-Xho fragment from pET15b/Vh1-258 (Addgene plasmid 46173) was subcloned into EGFP/V1-1066 (Addgene plasmid 46265) vector modified to contain unique Nde, Xho sites. Modifications were made by QuikChange PCR to facilitate cloning of cDNAs previously in the pET15b vector. The NdeI site present in the cytomegalovirus promoter region was removed (mutating adenine 234 to thymine), and a new NdeI site was introduced into the multiple cloning site immediately before the vinculin start codon. Additionally, the 5-XhoI site was removed (mutating cytosine 1345 to adenine), and a 3-XhoI site was introduced 3' to the vinculin cDNA in lieu of a PstI site. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 1-258 (VD1 domain) | 2026-08-15 01:15:30 | 3 |
|
mcherry(C1)_RepoMan Resource Report Resource Website |
RRID:Addgene_46274 | RepoMan | Homo sapiens | Kanamycin | PMID:16492807 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:mcherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 0 | ||
|
pEGFPC1/GgVcl 1-851 A50I mutant Resource Report Resource Website 1+ mentions |
RRID:Addgene_46269 | Vcl 1-851 A50I mutation | Gallus gallus | Kanamycin | PMID:16608855 | A50I mutation introduced into EGFP/V1-851 (Addgene plasmid 46268) by QCPCR mutation. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 1-851 (Vh) head domain, A50I mutation | 2026-08-15 01:15:30 | 2 |
|
pEGFPC1/GgVcl 1-1066 T12 mutant Resource Report Resource Website 1+ mentions |
RRID:Addgene_46266 | Vcl T12 mutant | Gallus gallus | Kanamycin | PMID:15728584 | T12 mutation introduced by QuikChange PCR to Addgene plasmid 46265. Mutant inhibits vinculin autoinhibition by ~ 100 fold, vinculin is partially activated and will bind talin, but not actin (unless both talin and actin are present at same time). | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | T12 mutant (D974;K975;R976; R978A) autoinhibition decreased by 100x | 2026-08-15 01:15:30 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
