Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

33,834 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
HeLa full-length MLCK-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46316 HeLa long myosin light chain kinase Homo sapiens Kanamycin PMID:15020676 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:30 2
Hela kinase-dead MLCK-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46317 HeLa long myosin light chain kinase-dead Homo sapiens Kanamycin PMID:15020676 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin E1626K 2026-08-15 01:15:30 3
pEGFPC1/GgVcl 1-258 A50I mutation
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46271 Vcl 1-258 (aka VD1) A50I mutation Gallus gallus Kanamycin PMID:16608855 A50I mutation introduced into EGFP/V1-258 (Addgene plasmid 46270) by QCPCR. Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 1-258 (VD1 domain) A50I mutation 2026-08-15 01:15:30 1
pEGFPC3/GgVcl 884-1066 (Vt)
 
Resource Report
Resource Website
RRID:Addgene_46272 Vcl 884-1066 (Vt) Gallus gallus Kanamycin PstI-ApaI fragment of pGEX3TV884-1066 subcloned into Pst-Apa cut pEGFP-C3)EGFP. Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 884-1066 (Vt) tail domain 2026-08-15 01:15:30 0
pEGFPC1/GgVcl 1-258 (aka VD1)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46270 Vcl 1-258 (aka VD1) Gallus gallus Kanamycin PMID:16608855 Nde-Xho fragment from pET15b/Vh1-258 (Addgene plasmid 46173) was subcloned into EGFP/V1-1066 (Addgene plasmid 46265) vector modified to contain unique Nde, Xho sites. Modifications were made by QuikChange PCR to facilitate cloning of cDNAs previously in the pET15b vector. The NdeI site present in the cytomegalovirus promoter region was removed (mutating adenine 234 to thymine), and a new NdeI site was introduced into the multiple cloning site immediately before the vinculin start codon. Additionally, the 5-XhoI site was removed (mutating cytosine 1345 to adenine), and a 3-XhoI site was introduced 3' to the vinculin cDNA in lieu of a PstI site. Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 1-258 (VD1 domain) 2026-08-15 01:15:30 3
mcherry(C1)_RepoMan
 
Resource Report
Resource Website
RRID:Addgene_46274 RepoMan Homo sapiens Kanamycin PMID:16492807 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:mcherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:30 0
pEGFPC1/GgVcl 1-851 A50I mutant
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46269 Vcl 1-851 A50I mutation Gallus gallus Kanamycin PMID:16608855 A50I mutation introduced into EGFP/V1-851 (Addgene plasmid 46268) by QCPCR mutation. Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 1-851 (Vh) head domain, A50I mutation 2026-08-15 01:15:30 2
pEGFPC1/GgVcl 1-1066 T12 mutant
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46266 Vcl T12 mutant Gallus gallus Kanamycin PMID:15728584 T12 mutation introduced by QuikChange PCR to Addgene plasmid 46265. Mutant inhibits vinculin autoinhibition by ~ 100 fold, vinculin is partially activated and will bind talin, but not actin (unless both talin and actin are present at same time). Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T12 mutant (D974;K975;R976; R978A) autoinhibition decreased by 100x 2026-08-15 01:15:30 2
pEGFPC1/GgVcl 1-1066 A50I K1306A, R1308A mutant
 
Resource Report
Resource Website
RRID:Addgene_46267 Vcl Gallus gallus Kanamycin Chicken vinculin, full length(EcoRI fragment of p1005 subcloned into EcoRI-cut pEGFP-C1); A50I mutation (alanine 50 to isoleucine) introduced by QCPCR. This mutant binds poorly (undetectably to talin in pull down assays; sensitivity of assay Kd= 10-20 uM). Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K1306A, R1308A, A50I mutation; talin binding deficient 2026-08-15 01:15:30 0
pEGFPC1/GgVcl 1-1066
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46265 Vcl Gallus gallus Kanamycin PMID:15728584 full length chicken vinculin (EcoRI fragment of p1005 subcloned into EcoRI-cut pEGFP-C1). ATG at bp 1390-1392. TAA at bp 4588-90. EGFP at N-terminus. Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:30 1
pENTR FL CPAP RNAi resistant
 
Resource Report
Resource Website
RRID:Addgene_46390 CPAP RNAi resistant mutant Homo sapiens Kanamycin PMID:22100914 Backbone Marker:Invitrogen; Backbone Size:2717; Vector Backbone:pENTR 1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin silent mutation that renders it resistant to siRNA :nucleotides 2862–2880, new sequence: 5′-AGAGTTAGCTAGGATCGAAGA-3′ 2026-08-15 01:15:31 0
pSEDuet40
 
Resource Report
Resource Website
RRID:Addgene_46378 TvoVMA intein Thermoplasma volcanium Kanamycin PMID:22001202 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:31 0
pJDJRSF05
 
Resource Report
Resource Website
RRID:Addgene_46379 NpuDnaE intein inactive Nostoc punctiforme Kanamycin PMID:19636943 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin C1A 2026-08-15 01:15:31 0
pALBRSF12
 
Resource Report
Resource Website
RRID:Addgene_46376 NpuDnaE intein, inactive Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin C1A, C+1A 2026-08-15 01:15:31 0
pHYRSF236
 
Resource Report
Resource Website
RRID:Addgene_46377 NpuDnaE intein delta variant, inactive Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin C1A, C+1A, deleted T76, V97, D98, L100 from NpuDnaE intein 2026-08-15 01:15:31 0
pSADuet502
 
Resource Report
Resource Website
RRID:Addgene_46373 NpuDnaB intein Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3564; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:31 0
pTK165_Mem-mCherry-4.1G-CTD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46362 4.1G C-terminal domain Homo sapiens Kanamycin PMID:23870127 Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin C-terminal domain from 886-1005 amino acids 2026-08-15 01:15:31 3
pSARSF505
 
Resource Report
Resource Website
RRID:Addgene_46832 GFPN-NpuDnaE_intein-GFP_C Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin stemmer GFP with superfolder mutations S30R and Y39N, and SYG->CYG in chromophore 2026-08-15 01:15:35 0
pICH86966::AtU6p::sgRNA_PDS
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46966 AtU6p::sgRNA_PDS Synthetic Kanamycin PMID:23929340 gRNA target sequence GCCGTTAATTTGAGAGTCCA Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:37 25
pEGFP-C1-FLAG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46956 FLAG tag Synthetic Kanamycin PMID:23897892 Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:37 9

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.