Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
HeLa full-length MLCK-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46316 | HeLa long myosin light chain kinase | Homo sapiens | Kanamycin | PMID:15020676 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 2 | ||
|
Hela kinase-dead MLCK-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46317 | HeLa long myosin light chain kinase-dead | Homo sapiens | Kanamycin | PMID:15020676 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | E1626K | 2026-08-15 01:15:30 | 3 | |
|
pEGFPC1/GgVcl 1-258 A50I mutation Resource Report Resource Website 1+ mentions |
RRID:Addgene_46271 | Vcl 1-258 (aka VD1) A50I mutation | Gallus gallus | Kanamycin | PMID:16608855 | A50I mutation introduced into EGFP/V1-258 (Addgene plasmid 46270) by QCPCR. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 1-258 (VD1 domain) A50I mutation | 2026-08-15 01:15:30 | 1 |
|
pEGFPC3/GgVcl 884-1066 (Vt) Resource Report Resource Website |
RRID:Addgene_46272 | Vcl 884-1066 (Vt) | Gallus gallus | Kanamycin | PstI-ApaI fragment of pGEX3TV884-1066 subcloned into Pst-Apa cut pEGFP-C3)EGFP. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 884-1066 (Vt) tail domain | 2026-08-15 01:15:30 | 0 | |
|
pEGFPC1/GgVcl 1-258 (aka VD1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_46270 | Vcl 1-258 (aka VD1) | Gallus gallus | Kanamycin | PMID:16608855 | Nde-Xho fragment from pET15b/Vh1-258 (Addgene plasmid 46173) was subcloned into EGFP/V1-1066 (Addgene plasmid 46265) vector modified to contain unique Nde, Xho sites. Modifications were made by QuikChange PCR to facilitate cloning of cDNAs previously in the pET15b vector. The NdeI site present in the cytomegalovirus promoter region was removed (mutating adenine 234 to thymine), and a new NdeI site was introduced into the multiple cloning site immediately before the vinculin start codon. Additionally, the 5-XhoI site was removed (mutating cytosine 1345 to adenine), and a 3-XhoI site was introduced 3' to the vinculin cDNA in lieu of a PstI site. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 1-258 (VD1 domain) | 2026-08-15 01:15:30 | 3 |
|
mcherry(C1)_RepoMan Resource Report Resource Website |
RRID:Addgene_46274 | RepoMan | Homo sapiens | Kanamycin | PMID:16492807 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:mcherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 0 | ||
|
pEGFPC1/GgVcl 1-851 A50I mutant Resource Report Resource Website 1+ mentions |
RRID:Addgene_46269 | Vcl 1-851 A50I mutation | Gallus gallus | Kanamycin | PMID:16608855 | A50I mutation introduced into EGFP/V1-851 (Addgene plasmid 46268) by QCPCR mutation. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 1-851 (Vh) head domain, A50I mutation | 2026-08-15 01:15:30 | 2 |
|
pEGFPC1/GgVcl 1-1066 T12 mutant Resource Report Resource Website 1+ mentions |
RRID:Addgene_46266 | Vcl T12 mutant | Gallus gallus | Kanamycin | PMID:15728584 | T12 mutation introduced by QuikChange PCR to Addgene plasmid 46265. Mutant inhibits vinculin autoinhibition by ~ 100 fold, vinculin is partially activated and will bind talin, but not actin (unless both talin and actin are present at same time). | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | T12 mutant (D974;K975;R976; R978A) autoinhibition decreased by 100x | 2026-08-15 01:15:30 | 2 |
|
pEGFPC1/GgVcl 1-1066 A50I K1306A, R1308A mutant Resource Report Resource Website |
RRID:Addgene_46267 | Vcl | Gallus gallus | Kanamycin | Chicken vinculin, full length(EcoRI fragment of p1005 subcloned into EcoRI-cut pEGFP-C1); A50I mutation (alanine 50 to isoleucine) introduced by QCPCR. This mutant binds poorly (undetectably to talin in pull down assays; sensitivity of assay Kd= 10-20 uM). | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | K1306A, R1308A, A50I mutation; talin binding deficient | 2026-08-15 01:15:30 | 0 | |
|
pEGFPC1/GgVcl 1-1066 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46265 | Vcl | Gallus gallus | Kanamycin | PMID:15728584 | full length chicken vinculin (EcoRI fragment of p1005 subcloned into EcoRI-cut pEGFP-C1). ATG at bp 1390-1392. TAA at bp 4588-90. EGFP at N-terminus. | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:30 | 1 | |
|
pENTR FL CPAP RNAi resistant Resource Report Resource Website |
RRID:Addgene_46390 | CPAP RNAi resistant mutant | Homo sapiens | Kanamycin | PMID:22100914 | Backbone Marker:Invitrogen; Backbone Size:2717; Vector Backbone:pENTR 1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | silent mutation that renders it resistant to siRNA :nucleotides 2862–2880, new sequence: 5′-AGAGTTAGCTAGGATCGAAGA-3′ | 2026-08-15 01:15:31 | 0 | |
|
pSEDuet40 Resource Report Resource Website |
RRID:Addgene_46378 | TvoVMA intein | Thermoplasma volcanium | Kanamycin | PMID:22001202 | Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:31 | 0 | ||
|
pJDJRSF05 Resource Report Resource Website |
RRID:Addgene_46379 | NpuDnaE intein inactive | Nostoc punctiforme | Kanamycin | PMID:19636943 | Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | C1A | 2026-08-15 01:15:31 | 0 | |
|
pALBRSF12 Resource Report Resource Website |
RRID:Addgene_46376 | NpuDnaE intein, inactive | Nostoc punctiforme | Kanamycin | PMID:23974115 | Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | C1A, C+1A | 2026-08-15 01:15:31 | 0 | |
|
pHYRSF236 Resource Report Resource Website |
RRID:Addgene_46377 | NpuDnaE intein delta variant, inactive | Nostoc punctiforme | Kanamycin | PMID:23974115 | Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | C1A, C+1A, deleted T76, V97, D98, L100 from NpuDnaE intein | 2026-08-15 01:15:31 | 0 | |
|
pSADuet502 Resource Report Resource Website |
RRID:Addgene_46373 | NpuDnaB intein | Nostoc punctiforme | Kanamycin | PMID:23974115 | Backbone Marker:Novagen; Backbone Size:3564; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:31 | 0 | ||
|
pTK165_Mem-mCherry-4.1G-CTD Resource Report Resource Website 1+ mentions |
RRID:Addgene_46362 | 4.1G C-terminal domain | Homo sapiens | Kanamycin | PMID:23870127 | Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI | Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | C-terminal domain from 886-1005 amino acids | 2026-08-15 01:15:31 | 3 |
|
pSARSF505 Resource Report Resource Website |
RRID:Addgene_46832 | GFPN-NpuDnaE_intein-GFP_C | Nostoc punctiforme | Kanamycin | PMID:23974115 | Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | stemmer GFP with superfolder mutations S30R and Y39N, and SYG->CYG in chromophore | 2026-08-15 01:15:35 | 0 | |
|
pICH86966::AtU6p::sgRNA_PDS Resource Report Resource Website 10+ mentions |
RRID:Addgene_46966 | AtU6p::sgRNA_PDS | Synthetic | Kanamycin | PMID:23929340 | gRNA target sequence GCCGTTAATTTGAGAGTCCA | Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:37 | 25 | |
|
pEGFP-C1-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_46956 | FLAG tag | Synthetic | Kanamycin | PMID:23897892 | Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:37 | 9 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.