Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:caenorhabditis elegans (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,881 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pJH4316
 
Resource Report
Resource Website
RRID:Addgene_200171 twk-40 Caenorhabditis elegans Ampicillin PMID:38598630 Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint. Backbone Marker:stratagene; Backbone Size:7189; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:40 0
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
 
Resource Report
Resource Website
RRID:Addgene_197599 Synaptogyrin-CRY2 (D387A+E490G + residues 1-535) Caenorhabditis elegans Ampicillin PMID:36535932 Backbone Marker:Joachim Messing; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin D387A, E490G 2026-08-15 01:29:41 0
pDV12 [psng-1::SNG-1::CRY2olig(535)]
 
Resource Report
Resource Website
RRID:Addgene_197596 Synaptogyrin-CRY2 (E490G + residues 1-535) Caenorhabditis elegans Ampicillin PMID:36535932 Backbone Marker:Joachim Messing; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin E490G 2026-08-15 01:29:40 0
pMS178
 
Resource Report
Resource Website
RRID:Addgene_215678 5'HA + MCS + loxP + rps-0p::5'ΔHygR Caenorhabditis elegans Ampicillin PMID:38351905 Vector Backbone:pMS81; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 5' ∆HYGR encodes aa1-226 2026-08-15 01:29:51 0
pJW2341
 
Resource Report
Resource Website
RRID:Addgene_186950 30aa linker::GFP-C1::IAA7 AID::3xFLAG::10aa linker Caenorhabditis elegans Kanamycin PMID:36029236 Backbone Size:2360; Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:23:18 0
pST_H9G2T8_CAEEL (pBS0342)
 
Resource Report
Resource Website
RRID:Addgene_185182 H9G2T8_CAEEL Caenorhabditis elegans Ampicillin PMID:35176859 This is one of the top performing targets in our apoptosis assay (it protected from apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:20 0
pST_A0A061ACN9_CAEEL (pBS0349)
 
Resource Report
Resource Website
RRID:Addgene_185187 A0A061ACN9_CAEEL Caenorhabditis elegans Ampicillin PMID:35176859 This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:19 0
pST_H9G2U1_CAEEL (pBS0346)
 
Resource Report
Resource Website
RRID:Addgene_185185 H9G2U1_CAEEL Caenorhabditis elegans Ampicillin PMID:35176859 This is one of the top performing targets in our apoptosis assay (it protected from apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:19 0
pST_H2FLK5_CAEEL_199-435 (pBS0696)
 
Resource Report
Resource Website
RRID:Addgene_185215 H2FLK5_CAEEL_199-435 Caenorhabditis elegans Ampicillin PMID:35176859 This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:19 0
pST_Q19228_CAEEL_51-127_noLink (pBS0733)
 
Resource Report
Resource Website
RRID:Addgene_185229 Q19228_CAEEL_51-127_noLink Caenorhabditis elegans Ampicillin PMID:35176859 This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:20 0
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_193050 Guide RNA Caenorhabditis elegans Ampicillin PMID:37401921 Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint. Backbone Marker:Phillips Lab; Backbone Size:3233; Vector Backbone:pZCS11; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:27:49 1
pZCS36 (Phsp16.41::Cas9(dpiRNA)::tbb-2 ‘3UTR)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_193048 hsp16.41p::Cas9(dpiRNA)::tbb-2 ‘3UTR Caenorhabditis elegans Ampicillin PMID:37401921 Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint. Backbone Marker:New England Biolabs; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:27:47 1
pJRM4 - [BAGp | gfp | tbb-2 UTR]
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_204617 [BAGp | gfp | tbb-2 UTR] Caenorhabditis elegans Ampicillin PMID:37426742 See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:49 1
pJRM3 - [BAGp | mScarlet | tbb-2 UTR]
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_204616 [BAGp | wrmScarlet | tbb-2 UTR] Caenorhabditis elegans Ampicillin PMID:37426742 See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:49 1
pSAH63 - [AFDp | wrmScarlet | tbb-2 UTR]
 
Resource Report
Resource Website
RRID:Addgene_200337 [AFDp | wrmScarlet | tbb-2 UTR] Caenorhabditis elegans Ampicillin See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:52 0
pSAH65 - [BAGp | wrmScarlet | tbb-2 UTR]
 
Resource Report
Resource Website
RRID:Addgene_200339 [BAGp | wrmScarlet | tbb-2 UTR] Caenorhabditis elegans Ampicillin See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:52 0
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR]
 
Resource Report
Resource Website
RRID:Addgene_200357 [AVHp | wrmScarlet | tbb-2 UTR] Caenorhabditis elegans Ampicillin See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:52 0
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR]
 
Resource Report
Resource Website
RRID:Addgene_200353 [AWAp | wrmScarlet | tbb-2 UTR] Caenorhabditis elegans Ampicillin See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:52 0
pSF11-wmiRFP713-T2A-HO1
 
Resource Report
Resource Website
RRID:Addgene_197246 wmiRFP713-T2A-HO1 Caenorhabditis elegans Ampicillin PMID:37666982 Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint. Vector Backbone:pSF11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:56 0
pHIT348
 
Resource Report
Resource Website
RRID:Addgene_204515 C-terminal fragment of cec-5 (C. elegans) Caenorhabditis elegans Kanamycin PMID:37078421 Backbone Size:6442; Vector Backbone:pHIT198 (derived from pET-28a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:27:58 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.