Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pJH4316 Resource Report Resource Website |
RRID:Addgene_200171 | twk-40 | Caenorhabditis elegans | Ampicillin | PMID:38598630 | Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint. | Backbone Marker:stratagene; Backbone Size:7189; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:29:40 | 0 | |
|
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry] Resource Report Resource Website |
RRID:Addgene_197599 | Synaptogyrin-CRY2 (D387A+E490G + residues 1-535) | Caenorhabditis elegans | Ampicillin | PMID:36535932 | Backbone Marker:Joachim Messing; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | D387A, E490G | 2026-08-15 01:29:41 | 0 | |
|
pDV12 [psng-1::SNG-1::CRY2olig(535)] Resource Report Resource Website |
RRID:Addgene_197596 | Synaptogyrin-CRY2 (E490G + residues 1-535) | Caenorhabditis elegans | Ampicillin | PMID:36535932 | Backbone Marker:Joachim Messing; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | E490G | 2026-08-15 01:29:40 | 0 | |
|
pMS178 Resource Report Resource Website |
RRID:Addgene_215678 | 5'HA + MCS + loxP + rps-0p::5'ΔHygR | Caenorhabditis elegans | Ampicillin | PMID:38351905 | Vector Backbone:pMS81; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 5' ∆HYGR encodes aa1-226 | 2026-08-15 01:29:51 | 0 | |
|
pJW2341 Resource Report Resource Website |
RRID:Addgene_186950 | 30aa linker::GFP-C1::IAA7 AID::3xFLAG::10aa linker | Caenorhabditis elegans | Kanamycin | PMID:36029236 | Backbone Size:2360; Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:18 | 0 | ||
|
pST_H9G2T8_CAEEL (pBS0342) Resource Report Resource Website |
RRID:Addgene_185182 | H9G2T8_CAEEL | Caenorhabditis elegans | Ampicillin | PMID:35176859 | This is one of the top performing targets in our apoptosis assay (it protected from apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 | Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:20 | 0 | |
|
pST_A0A061ACN9_CAEEL (pBS0349) Resource Report Resource Website |
RRID:Addgene_185187 | A0A061ACN9_CAEEL | Caenorhabditis elegans | Ampicillin | PMID:35176859 | This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 | Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:19 | 0 | |
|
pST_H9G2U1_CAEEL (pBS0346) Resource Report Resource Website |
RRID:Addgene_185185 | H9G2U1_CAEEL | Caenorhabditis elegans | Ampicillin | PMID:35176859 | This is one of the top performing targets in our apoptosis assay (it protected from apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 | Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:19 | 0 | |
|
pST_H2FLK5_CAEEL_199-435 (pBS0696) Resource Report Resource Website |
RRID:Addgene_185215 | H2FLK5_CAEEL_199-435 | Caenorhabditis elegans | Ampicillin | PMID:35176859 | This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 | Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:19 | 0 | |
|
pST_Q19228_CAEEL_51-127_noLink (pBS0733) Resource Report Resource Website |
RRID:Addgene_185229 | Q19228_CAEEL_51-127_noLink | Caenorhabditis elegans | Ampicillin | PMID:35176859 | This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 | Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:20 | 0 | |
|
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT) Resource Report Resource Website 1+ mentions |
RRID:Addgene_193050 | Guide RNA | Caenorhabditis elegans | Ampicillin | PMID:37401921 | Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint. | Backbone Marker:Phillips Lab; Backbone Size:3233; Vector Backbone:pZCS11; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:49 | 1 | |
|
pZCS36 (Phsp16.41::Cas9(dpiRNA)::tbb-2 ‘3UTR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_193048 | hsp16.41p::Cas9(dpiRNA)::tbb-2 ‘3UTR | Caenorhabditis elegans | Ampicillin | PMID:37401921 | Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint. | Backbone Marker:New England Biolabs; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:47 | 1 | |
|
pJRM4 - [BAGp | gfp | tbb-2 UTR] Resource Report Resource Website 1+ mentions |
RRID:Addgene_204617 | [BAGp | gfp | tbb-2 UTR] | Caenorhabditis elegans | Ampicillin | PMID:37426742 | See www.wormbuilder.org/BioParts for more information. | Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:49 | 1 | |
|
pJRM3 - [BAGp | mScarlet | tbb-2 UTR] Resource Report Resource Website 1+ mentions |
RRID:Addgene_204616 | [BAGp | wrmScarlet | tbb-2 UTR] | Caenorhabditis elegans | Ampicillin | PMID:37426742 | See www.wormbuilder.org/BioParts for more information. | Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:49 | 1 | |
|
pSAH63 - [AFDp | wrmScarlet | tbb-2 UTR] Resource Report Resource Website |
RRID:Addgene_200337 | [AFDp | wrmScarlet | tbb-2 UTR] | Caenorhabditis elegans | Ampicillin | See www.wormbuilder.org/BioParts for more information. | Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:52 | 0 | ||
|
pSAH65 - [BAGp | wrmScarlet | tbb-2 UTR] Resource Report Resource Website |
RRID:Addgene_200339 | [BAGp | wrmScarlet | tbb-2 UTR] | Caenorhabditis elegans | Ampicillin | See www.wormbuilder.org/BioParts for more information. | Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:52 | 0 | ||
|
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR] Resource Report Resource Website |
RRID:Addgene_200357 | [AVHp | wrmScarlet | tbb-2 UTR] | Caenorhabditis elegans | Ampicillin | See www.wormbuilder.org/BioParts for more information. | Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:52 | 0 | ||
|
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR] Resource Report Resource Website |
RRID:Addgene_200353 | [AWAp | wrmScarlet | tbb-2 UTR] | Caenorhabditis elegans | Ampicillin | See www.wormbuilder.org/BioParts for more information. | Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:52 | 0 | ||
|
pSF11-wmiRFP713-T2A-HO1 Resource Report Resource Website |
RRID:Addgene_197246 | wmiRFP713-T2A-HO1 | Caenorhabditis elegans | Ampicillin | PMID:37666982 | Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint. | Vector Backbone:pSF11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:56 | 0 | |
|
pHIT348 Resource Report Resource Website |
RRID:Addgene_204515 | C-terminal fragment of cec-5 (C. elegans) | Caenorhabditis elegans | Kanamycin | PMID:37078421 | Backbone Size:6442; Vector Backbone:pHIT198 (derived from pET-28a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:27:58 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.