Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHsp83-NLS-HA-2xMCP-2xTagRFP-T Resource Report Resource Website 1+ mentions |
RRID:Addgene_71242 | NLS-2xMCP-2xTagRFP-T | Other | Ampicillin | PMID:25792328 | Vector Backbone:pHsp83; Vector Types:Insect Expression, P element-mediated germline transformation; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:09 | 1 | ||
|
pKM343 Resource Report Resource Website |
RRID:Addgene_71487 | loxP-hyg-cat-loxP | Other | Chloramphenicol | PMID:25779316 | This vector contains a hyg-cat cassette, flanked by loxP sites, that can be used for the construction of recombineeng substrates for M. smegmatis or M. tuberculosis. It contains a 1 bp change (relative to starting plasmid pJM1) at position 2008 (G to C) that eliminate a potential stop codon that could interfere with expression of downstream functions following excision of the cassette from the chromosome by Cre recombinase. The hygromycin resistance gene encodes M13I and I111T variants compared to the NCBI reference [ADL66925.1]. These variants should not interfere with function. | Backbone Marker:Jeffery Murry - Eric Rubin Lab; Vector Backbone:pJM1; Vector Types:Bacterial Expression, Source of loxP-hyg-cat- loxP for PCR amplification.; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:19:11 | 0 | |
|
pDZ585 pKAN 2x-mCherry Resource Report Resource Website |
RRID:Addgene_72236 | 2x-mCherry | Other | Ampicillin | PMID:26694838 | Backbone Size:4821; Vector Backbone:pKAN; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:18 | 0 | ||
|
pCORE-UK Resource Report Resource Website 1+ mentions |
RRID:Addgene_72238 | KlURA3 | Other | Ampicillin | PMID:15260239 | The Resnik and Storici Labs recommend reading the following review articles for more information on this plasmid: - Storici and Resnick Method Enzymol 2006 PMID: 16793410 - Stuckey et al., Meth. Mol. Biol. 2011 PMID: 21660695 - Stuckey and Storici Methods Enzymol 2013 PMID: 24182920 | Vector Backbone:pFA6aKlURA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:18 | 1 | |
|
pCDH-CB-iCre-P2A-tdTomato-T2A-Puro Resource Report Resource Website |
RRID:Addgene_72255 | iCre-P2A-tdTomato-T2A-Puro | Other | Ampicillin | Backbone Marker:Systembio; Backbone Size:6677; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:18 | 0 | |||
|
pCDH-CB-FLPe-P2A-copGFP-T2A-Puro Resource Report Resource Website |
RRID:Addgene_72258 | FLPe-P2A-copGFp-T2A-Puro | Other | Ampicillin | Backbone Marker:Systembio; Backbone Size:6677; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:18 | 0 | |||
|
pCDH-CB-copGFP-T2A-iCre Resource Report Resource Website |
RRID:Addgene_72256 | copGFP-T2A-iCre | Other | Ampicillin | Backbone Marker:Systembio; Backbone Size:6677; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:18 | 0 | |||
|
pCDH-EF1-copGFP-T2A-Puro Resource Report Resource Website 10+ mentions |
RRID:Addgene_72263 | copGFP-T2A-Puro | Other | Ampicillin | Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:18 | 24 | |||
|
pCDH-CMV-mCherry-T2A-Puro Resource Report Resource Website 10+ mentions |
RRID:Addgene_72264 | mCherry-T2A-Puro | Other | Ampicillin | Backbone Marker:Systembio; Backbone Size:6227; Vector Backbone:pCDH-CMV-MCS; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:18 | 15 | |||
|
pLenti CMV_mIFP IRES EGFP Resource Report Resource Website |
RRID:Addgene_72443 | mIFP T2A HO1 IRES EGFP | Other | Ampicillin | PMID:26098020 | Vector Backbone:pLentiCMV dest#2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:20 | 0 | ||
|
mGDF8 donor mCherry-PA Resource Report Resource Website |
RRID:Addgene_72596 | mCherry-puromycin cassetter | Other | Ampicillin | PMID:23900226 | Plasmid contains left and right homology arms for mouse GDF8 flanking the mCherry-puromycin cassette. ccdB gene is nonfunctional. | Backbone Marker:Rudolf Jaenisch (Addgene plasmid # 22075); Backbone Size:6602; Vector Backbone:AAVS1 SA-2A-puro-pA donor; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:21 | 0 | |
|
pAdx-CMV-LacZ Resource Report Resource Website |
RRID:Addgene_73345 | CMV-LacZ | Other | Ampicillin | Backbone Marker:Clontech; Backbone Size:32705; Vector Backbone:pAdenoX; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:28 | 0 | |||
|
pAdx-CMV-copGFP Resource Report Resource Website |
RRID:Addgene_73346 | CMV-copGFP | Other | Ampicillin | Backbone Marker:Clontech; Backbone Size:32705; Vector Backbone:pAdenoX; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:28 | 0 | |||
|
pSIREN-RetroQ-shLuc Resource Report Resource Website 1+ mentions |
RRID:Addgene_73666 | shRNA to Luciferase | Other | Ampicillin | PMID:28969075 | Backbone Marker:Clonetech; Vector Backbone:pSIREN RetroQ; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:31 | 2 | ||
|
pMLS292 Resource Report Resource Website |
RRID:Addgene_73725 | 2xNLS-mCherry + Cbr-unc-119 | Other | Kanamycin | PMID:26837755 | Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:19:31 | 0 | ||
|
pMLS291 Resource Report Resource Website 1+ mentions |
RRID:Addgene_73724 | mCherry + Cbr-unc-119 | Other | Kanamycin | PMID:26837755 | Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:19:31 | 1 | ||
|
pMLS286 Resource Report Resource Website |
RRID:Addgene_73723 | tagRFP + Cbr-unc-119 | Other | Kanamycin | PMID:26837755 | Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:19:31 | 0 | ||
|
pMLS272 Resource Report Resource Website |
RRID:Addgene_73728 | syntron embedded C-terminal FLP-on | Other | Kanamycin | PMID:26837755 | Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:19:31 | 0 | ||
|
pMLS338 Resource Report Resource Website |
RRID:Addgene_73719 | Unc-32::GFP(Cbr-unc-119) | Other | Ampicillin | PMID:26837755 | 2nd Insert: pU6::Unc-32 sgRNA; oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC | Vector Backbone:pMLS256; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:31 | 0 | |
|
pMLS257 Resource Report Resource Website 1+ mentions |
RRID:Addgene_73716 | SapI repair template insertion site | Other | Ampicillin | PMID:26837755 | Backbone Marker:Agilent Technologies; Vector Backbone:pBluescript II; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:31 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
