Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 420 showing 8381 ~ 8400 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_164995

http://www.addgene.org/164995

Species: Homo sapiens
Genetic Insert: TRAV
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_164995 Copy   


  • RRID:Addgene_164996

http://www.addgene.org/164996

Species: Homo sapiens
Genetic Insert: TRB
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_164996 Copy   


  • RRID:Addgene_164993

    This resource has 1+ mentions.

http://www.addgene.org/164993

Species: Homo sapiens
Genetic Insert: gRNA against TRAC
Vector Backbone Description: Vector Backbone:pXPR_001 (lentiCRISPRv1, Addgene #49535); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_164993 Copy   


  • RRID:Addgene_165049

http://www.addgene.org/165049

Species: Other
Genetic Insert: P-URA3>KlURA3>T-AgTEF1-P-TEF1>TRX1-AID*>yEGFP>T-PGK1-P-ACS2>OsTIR1opt>T-URA3
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165049 Copy   


http://www.addgene.org/165040

Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33589718

Proper citation: RRID:Addgene_165040 Copy   


http://www.addgene.org/165041

Species: Saccharomyces cerevisiae
Genetic Insert: I-SceI
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33589718

Proper citation: RRID:Addgene_165041 Copy   


  • RRID:Addgene_164999

    This resource has 1+ mentions.

http://www.addgene.org/164999

Species: Homo sapiens
Genetic Insert: TRAV
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_164999 Copy   


  • RRID:Addgene_164997

http://www.addgene.org/164997

Species: Homo sapiens
Genetic Insert: TRAV
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_164997 Copy   


  • RRID:Addgene_165035

http://www.addgene.org/165035

Species: Mus musculus
Genetic Insert: dnMRTFA
Vector Backbone Description: Vector Backbone:aav-tnt-gfp-v2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33361330

Proper citation: RRID:Addgene_165035 Copy   


http://www.addgene.org/164984

Species: Homo sapiens
Genetic Insert: NPRL3
Vector Backbone Description: Backbone Size:4960; Vector Backbone:pCAG TWIN STREP FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31672913

Proper citation: RRID:Addgene_164984 Copy   


  • RRID:Addgene_165037

http://www.addgene.org/165037

Species: Mus musculus
Genetic Insert: Mrtfa
Vector Backbone Description: Vector Backbone:aav-tnt-gfp-v2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33361330
Comments: Please note that the Addgene verified sequence detected a 22bp deletion in the ITR region. This deletion does not affect plasmid function.

Proper citation: RRID:Addgene_165037 Copy   


  • RRID:Addgene_16499

http://www.addgene.org/16499

Species: Homo sapiens
Genetic Insert: Pig5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305847

Proper citation: RRID:Addgene_16499 Copy   


  • RRID:Addgene_165031

    This resource has 1+ mentions.

http://www.addgene.org/165031

Species: Homo sapiens
Genetic Insert: Rheb
Vector Backbone Description: Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33157014

Proper citation: RRID:Addgene_165031 Copy   


http://www.addgene.org/165030

Species: Synthetic
Genetic Insert: LaGFP(N)-cpFRB2-T2A-FKBP-LaGFP(C)
Vector Backbone Description: Backbone Size:5646; Vector Backbone:pTriEX; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32277990

Proper citation: RRID:Addgene_165030 Copy   


  • RRID:Addgene_165068

http://www.addgene.org/165068

Species: Other
Genetic Insert: gal80Arm1-P-AgTEF1-KlURA3-T-AgTEF1-gal80Arm2
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165068 Copy   


  • RRID:Addgene_165069

http://www.addgene.org/165069

Species: Other
Genetic Insert: gal80Arm1-P-TPI1-KanMX4-gal80Arm2
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165069 Copy   


  • RRID:Addgene_165067

http://www.addgene.org/165067

Species: Other
Genetic Insert: T-RPL3>ERG20>P-GAL1-P-GAL2>Y-FAST>ErB1.2A-AcNES1>T-RPL41B
Vector Backbone Description: Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Comments: Please note Addgene NGS result identified several mutations in LEU2- V73A, A82G, L199V, D304N. Depositor confirms this does not affect plasmid function. On the contrary the depositor has found "significant improvement on the productivities in the strain harbouring this plasmid."

Proper citation: RRID:Addgene_165067 Copy   


  • RRID:Addgene_16503

http://www.addgene.org/16503

Species: Homo sapiens
Genetic Insert: Pig9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305847

Proper citation: RRID:Addgene_16503 Copy   


  • RRID:Addgene_16501

http://www.addgene.org/16501

Genetic Insert: Mad-binding element from Vg
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9660945
Comments: Four copies of the Mad-binding element from Vg (GCTTGGACTGCCGTCGCGATTC) are cloned into pGL3.

Proper citation: RRID:Addgene_16501 Copy   


  • RRID:Addgene_165061

http://www.addgene.org/165061

Species: Other
Genetic Insert: P-URA3>KlURA3>T-AgTEF1- T-PGK1-P-ACS2> SKP1>OsTIR1opt>T-URA3
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165061 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X