Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: dCAS9(D10A, N863A)-VP64_2A_Blast
Vector Backbone Description: Vector Backbone:plenti; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494202
Comments: IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library.
For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
Proper citation: RRID:Addgene_61425 Copy
Species: Synthetic
Genetic Insert: Red Fluorescent Protein
Vector Backbone Description: Backbone Marker:Allan Gurtan (Phil Sharp Lab); Vector Backbone:pCAGGs; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_127347 Copy
Genetic Insert: Firefly luciferase
Vector Backbone Description: Vector Backbone:pGL4.13; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31171704
Proper citation: RRID:Addgene_127333 Copy
Genetic Insert: nanoLuciferase
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31171704
Proper citation: RRID:Addgene_127299 Copy
Genetic Insert: nanoLuciferase
Vector Backbone Description: Vector Backbone:pcDNA3.1D; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31171704
Proper citation: RRID:Addgene_127332 Copy
Species: Homo sapiens
Genetic Insert: Keratin-miRFP670nano
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30655515
Proper citation: RRID:Addgene_127437 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1-miRFP670nano
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30655515
Proper citation: RRID:Addgene_127435 Copy
Species: Mus musculus
Genetic Insert: Calmodulin 1
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31239443
Proper citation: RRID:Addgene_127393 Copy
Genetic Insert: uORF(M)-Cas9
Vector Backbone Description: Backbone Marker:Johannes Bischof and Konrad Basler; Vector Backbone:pUASTattB; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32053108
Proper citation: RRID:Addgene_127384 Copy
Species: Other
Genetic Insert: uORF(S)-Cas9
Vector Backbone Description: Backbone Marker:Johannes Bischof and Konrad Basler; Vector Backbone:pUASTattB; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32053108
Proper citation: RRID:Addgene_127383 Copy
Species: Rattus norvegicus
Genetic Insert: calcium/calmodulin-dependent protein kinase II alpha
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31239443
Proper citation: RRID:Addgene_127389 Copy
Species: Homo sapiens
Genetic Insert: miRFP670nano-human alpha-tubulin
Vector Backbone Description: Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30655515
Proper citation: RRID:Addgene_127429 Copy
Species: Homo sapiens
Genetic Insert: miRFP670nano-human beta-actin
Vector Backbone Description: Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30655515
Proper citation: RRID:Addgene_127428 Copy
Genetic Insert: mqsR toxin
Vector Backbone Description: Vector Backbone:pDS132; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31201277
Proper citation: RRID:Addgene_127450 Copy
Vector Backbone Description: Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_127458 Copy
Species: Other
Genetic Insert: Integrase 9 coding sequence codon optimized for A. thaliana expression.
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32444777
Comments: The whole insert (promoter, CDS and terminator) was synthesized and cloned into backbone plasmid. The Actin 2 promoter came from Aragao, F. J. L., et al. Plant Science 168, 1227-1233 (2005) and the NOS terminator sequence from pBI426 plasmid of Datla, R.S., et al. Gene 101, 239-246 (1991). The original integrase 9 coding sequence (before A. thaliana codon optimization) was obtained from Yang, L. et al. Nat. Methods 11, 1261-1266 (2014).
Proper citation: RRID:Addgene_127533 Copy
Species: Other
Genetic Insert: Integrase 7 coding sequence codon optimized for A. thaliana expression.
Vector Backbone Description: Vector Backbone:pSB3K3; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32444777
Comments: The whole insert (promoter, CDS and terminator) was synthesized and cloned into backbone plasmid. The Actin 2 promoter came from Aragao, F. J. L., et al. Plant Science 168, 1227-1233 (2005) and the NOS terminator sequence from pBI426 plasmid of Datla, R.S., et al. Gene 101, 239-246 (1991). The original integrase 7 coding sequence (before A. thaliana codon optimization) was obtained from Yang, L. et al. Nat. Methods 11, 1261-1266 (2014).
Proper citation: RRID:Addgene_127532 Copy
Species: Other
Genetic Insert: Integrase 5 coding sequence codon optimized for A. thaliana expression.
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32444777
Comments: The whole insert (promoter, CDS and terminator) was synthesized and cloned into backbone plasmid. The Actin 2 promoter came from Aragao, F. J. L., et al. Plant Science 168, 1227-1233 (2005) and the NOS terminator sequence from pBI426 plasmid of Datla, R.S., et al. Gene 101, 239-246 (1991). The original integrase 5 coding sequence (before A. thaliana codon optimization) was obtained from Yang, L. et al. Nat. Methods 11, 1261-1266 (2014).
Proper citation: RRID:Addgene_127531 Copy
Species: Other
Genetic Insert: Integrase 4 coding sequence codon optimized for A. thaliana expression.
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32444777
Comments: The whole insert (promoter, CDS and terminator) was synthesized and cloned into backbone plasmid. The Actin 2 promoter came from Aragao, F. J. L., et al. Plant Science 168, 1227-1233 (2005) and the NOS terminator sequence from pBI426 plasmid of Datla, R.S., et al. Gene 101, 239-246 (1991). The original integrase 4 coding sequence (before A. thaliana codon optimization) was obtained from Yang, L. et al. Nat. Methods 11, 1261-1266 (2014).
Proper citation: RRID:Addgene_127530 Copy
Species: Homo sapiens
Genetic Insert: SOX2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6150; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31221664
Proper citation: RRID:Addgene_127537 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
