Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 420 showing 8381 ~ 8400 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_123953

http://www.addgene.org/123953

Species: Homo sapiens
Genetic Insert: RelA
Vector Backbone Description: Vector Backbone:MTK0_027; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31686495
Comments: Type 3b parts are generally reserved for c-terminal coding sequences in the MTK. Please visit https://www.biorxiv.org/content/10.1101/506188v2 for BioRxiv preprint

Proper citation: RRID:Addgene_123953 Copy   


  • RRID:Addgene_12976

    This resource has 10+ mentions.

http://www.addgene.org/12976

Species: Homo sapiens
Genetic Insert: Cdc42 DN
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6100; Vector Backbone:pcDNA3-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10734125

Proper citation: RRID:Addgene_12976 Copy   


  • RRID:Addgene_12973

    This resource has 1+ mentions.

http://www.addgene.org/12973

Species: Homo sapiens
Genetic Insert: Cdc42 DN
Vector Backbone Description: Backbone Size:4750; Vector Backbone:pRK5-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_12973 Copy   


  • RRID:Addgene_12971

    This resource has 1+ mentions.

http://www.addgene.org/12971

Species: Homo sapiens
Genetic Insert: Cdc42 constitutively active
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_12971 Copy   


  • RRID:Addgene_12972

    This resource has 1+ mentions.

http://www.addgene.org/12972

Species: Homo sapiens
Genetic Insert: Cdc42
Vector Backbone Description: Backbone Size:4750; Vector Backbone:pRK5-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_12972 Copy   


  • RRID:Addgene_12970

http://www.addgene.org/12970

Species: Homo sapiens
Genetic Insert: Cdc42 DN
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_12970 Copy   


http://www.addgene.org/129721

Species: Homo sapiens
Genetic Insert: Seipin
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pSH-EFIRES-P; Vector Types:Mammalian Expression, CRISPR, TALEN, Human safe harbor locus (A AVS1) site-specific integration; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451765

Proper citation: RRID:Addgene_129721 Copy   


http://www.addgene.org/129722

Species: Homo sapiens
Genetic Insert: Seipin
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pSH-EFIRES-P; Vector Types:Mammalian Expression, CRISPR, TALEN, Human safe harbor locus (A AVS1) site-specific integration; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451765

Proper citation: RRID:Addgene_129722 Copy   


  • RRID:Addgene_129726

    This resource has 1+ mentions.

http://www.addgene.org/129726

Species: Homo sapiens
Genetic Insert: SpCas9 and sgAAVS1-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451765

Proper citation: RRID:Addgene_129726 Copy   


http://www.addgene.org/129719

Species: Homo sapiens
Genetic Insert: Seipin
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pSH-EFIRES-B; Vector Types:Mammalian Expression, CRISPR, TALEN, Human safe harbor locus (A AVS1) site-specific integration; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451765

Proper citation: RRID:Addgene_129719 Copy   


http://www.addgene.org/129789

Species: Homo sapiens
Genetic Insert: ADRB2
Vector Backbone Description: Backbone Marker:Genewiz; Backbone Size:6350; Vector Backbone:pUC57; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33084570

Proper citation: RRID:Addgene_129789 Copy   


  • RRID:Addgene_129776

    This resource has 1+ mentions.

http://www.addgene.org/129776

Species: Homo sapiens
Genetic Insert: human MYC
Vector Backbone Description: Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31186238
Comments: The plasmid contains loxp sites so it´s not ideal for experiments in mice expressing Cre.

Proper citation: RRID:Addgene_129776 Copy   


  • RRID:Addgene_12980

    This resource has 10+ mentions.

http://www.addgene.org/12980

Species: Homo sapiens
Genetic Insert: Rac1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6100; Vector Backbone:pcDNA3-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10734125

Proper citation: RRID:Addgene_12980 Copy   


  • RRID:Addgene_12994

http://www.addgene.org/12994

Species: Homo sapiens
Genetic Insert: TSP-2
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Includes 1.6 kb of the 3' untranslated region. Note that there is an internal EcoRI site. The clone was isolated from a cDNA library to prepare probes. We did not submit a sequence of TSP-2 to the NCBI. There are mismatches with NCBI sequence may be polymorophisms.

Proper citation: RRID:Addgene_12994 Copy   


  • RRID:Addgene_13004

    This resource has 1+ mentions.

http://www.addgene.org/13004

Species: Homo sapiens
Genetic Insert: human sulfatase 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/Myc-His(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12368295

Proper citation: RRID:Addgene_13004 Copy   


  • RRID:Addgene_13002

    This resource has 1+ mentions.

http://www.addgene.org/13002

Species: Homo sapiens
Genetic Insert: COMP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7713493
Comments: Includes complete coding region.

Proper citation: RRID:Addgene_13002 Copy   


  • RRID:Addgene_13003

    This resource has 1+ mentions.

http://www.addgene.org/13003

Species: Homo sapiens
Genetic Insert: human sulfatase 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/Myc-His(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12368295

Proper citation: RRID:Addgene_13003 Copy   


  • RRID:Addgene_13014

    This resource has 1+ mentions.

http://www.addgene.org/13014

Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 1
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Proper citation: RRID:Addgene_13014 Copy   


  • RRID:Addgene_13012

    This resource has 1+ mentions.

http://www.addgene.org/13012

Species: Homo sapiens
Genetic Insert: Wolfram Syndrome 1
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16195229

Proper citation: RRID:Addgene_13012 Copy   


  • RRID:Addgene_13010

    This resource has 1+ mentions.

http://www.addgene.org/13010

Species: Homo sapiens
Genetic Insert: Inositol Requiring Enzyme-1
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16950141

Proper citation: RRID:Addgene_13010 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X