Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 4
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Proper citation: RRID:Addgene_13018 Copy
Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 8
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Proper citation: RRID:Addgene_13024 Copy
Species: Homo sapiens
Genetic Insert: ELAM
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_13029 Copy
Species: Homo sapiens
Genetic Insert: hHR23B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1D V5 His TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15064742
Comments: You can cut out the hHR23B insert with HindIII and XhoI.
Proper citation: RRID:Addgene_13054 Copy
Species: Homo sapiens
Genetic Insert: Nucleolin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2897; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10760958
Proper citation: RRID:Addgene_13037 Copy
Species: Homo sapiens
Genetic Insert: GPX-1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7684384
Proper citation: RRID:Addgene_13038 Copy
Species: Homo sapiens
Genetic Insert: TPI-PTC1
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380
Proper citation: RRID:Addgene_130699 Copy
Species: Homo sapiens
Genetic Insert: TPI-Wildtype
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380
Proper citation: RRID:Addgene_130697 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130691 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-9.47A-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130687 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-11E.12D-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130684 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130682 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-10A.11D-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130683 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-36.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130680 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-36
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130681 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-46.47A-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130677 Copy
Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-10A.12D-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896
Proper citation: RRID:Addgene_130678 Copy
Species: Homo sapiens
Genetic Insert: KCNK4
Vector Backbone Description: Vector Backbone:pPICZ; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25500157
Proper citation: RRID:Addgene_130672 Copy
Species: Homo sapiens
Genetic Insert: 3 copies of human SUMO1 separated by (GGS)4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pC1-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27374333
Proper citation: RRID:Addgene_130703 Copy
Species: Homo sapiens
Genetic Insert: Beta Globin
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380
Proper citation: RRID:Addgene_130700 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.