Plasmids   Select Another Resource Report Type

http://www.addgene.org/1790

Species: Homo sapiens
Genetic Insert: FOXO3a
Vector Backbone Description: Backbone Size:4968; Vector Backbone:pGex 4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10102273
Comments: See author's sequence and map.

Proper citation: RRID:Addgene_1790 Copy   

•   Source: Addgene

http://www.addgene.org/179097

Species: Synthetic
Genetic Insert: ABE8e
Vector Backbone Description: Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179097 Copy   

•   Source: Addgene

http://www.addgene.org/179095

Species: Synthetic
Genetic Insert: BE3.9 (Cas9-NG)
Vector Backbone Description: Vector Backbone:pRDA_256; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179095 Copy   

•   Source: Addgene

http://www.addgene.org/179098

Species: Synthetic
Genetic Insert: ABE8e (Cas9-NG)
Vector Backbone Description: Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179098 Copy   

•   Source: Addgene

http://www.addgene.org/179099

Species: Synthetic
Genetic Insert: ABE8e (SpG)
Vector Backbone Description: Vector Backbone:pRDA_426; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35288574

Proper citation: RRID:Addgene_179099 Copy   

•   Source: Addgene

http://www.addgene.org/22007

Species: Homo sapiens
Genetic Insert: PA-Rac1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. Further remarks from the Hahn lab regarding some mutations in the fluorescent marker: "the C-S mutation was introduced by us to allow site specific labeling of the protein and we have not detected any effect. The F-L mutation reverts the Venus sequence back to the YFP sequence at this site. It will have a very slight detrimental effect on the maturation speed of the chromophore, but will not affect the stability or wavelength of the chromophore. Neither of these 2 mutations will have any effect on the function of the Lov-Rac construct , and the Venus will still function as it should, i.e. as a reporter for the construct."

Proper citation: RRID:Addgene_22007 Copy   

•   Source: Addgene

http://www.addgene.org/21967

Genetic Insert: CMV d2eGFP CXCR4 control sponge
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17694064
Comments: From Supplementary Table 1: "CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 spong, 4 sites: AAGUUUUCAGAAAGCUAACA"

Proper citation: RRID:Addgene_21967 Copy   

•   Source: Addgene

http://www.addgene.org/21966

Species: Homo sapiens
Genetic Insert: NFkB p65 subunit
Vector Backbone Description: Backbone Marker:Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989); Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1542686

Proper citation: RRID:Addgene_21966 Copy   

•   Source: Addgene

http://www.addgene.org/21965

Species: Homo sapiens
Genetic Insert: NF-kB p50 subunit
Vector Backbone Description: Backbone Marker:Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989); Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1542686

Proper citation: RRID:Addgene_21965 Copy   

•   Source: Addgene

http://www.addgene.org/21964

Species: Homo sapiens
Genetic Insert: si NEDD9
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17676035

Proper citation: RRID:Addgene_21964 Copy   

•   Source: Addgene

http://www.addgene.org/22019

Species: Aequorea Victoria
Genetic Insert: VN173
Vector Backbone Description: Backbone Marker:Fire lab 1995 kit; Backbone Size:3993; Vector Backbone:pPD4983; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388940
Comments: Hiatt, S.M., Shyu, Y., Duren, H.M, and Hu, C.D. Bimolecular fluorescence complementation (BiFC) analysis of protein interactions in living C. elegans. Methods, 45:185-191 (2008) Multicloning sites betwee Myc and VN173 are avaialble

Proper citation: RRID:Addgene_22019 Copy   

•   Source: Addgene

http://www.addgene.org/22017

Species: Homo sapiens
Genetic Insert: PA-Rac1-T17N
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt.

Proper citation: RRID:Addgene_22017 Copy   

•   Source: Addgene

http://www.addgene.org/21961

Genetic Insert: Ires GFP
Vector Backbone Description: Backbone Size:11476; Vector Backbone:LZRS-pBMN-Z-delta; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16814714

Proper citation: RRID:Addgene_21961 Copy   

•   Source: Addgene

http://www.addgene.org/21899

Species: Mus musculus
Genetic Insert: CHOP10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline
Defining Citation: PMID:1547942
Comments: Note that the phagemid had a scrambled insert and the portion 3' of the CHOP-10 coding region (in red-see author's map) is not from the CHOP gene. If you wish to obtain a CHOP probe for hybridization experiments we suggest excising the HD3-Nhe1 fragment that contains CHOP coding sequence. Note that this plasmid must be propagated in P3-containing host strain such as DH10B/P3 under combined amp (25mcg/ml)/tet (10mcg/ml) selection pressure.

Proper citation: RRID:Addgene_21899 Copy   

•   Source: Addgene

http://www.addgene.org/21898

Species: Mus musculus
Genetic Insert: CHOP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4310; Vector Backbone:pGL3 and pGL2 modified; Vector Types:Non-viral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381086
Comments: This reporter gene closely tracks the expression of endogenous CHOP.

Proper citation: RRID:Addgene_21898 Copy   

•   Source: Addgene

http://www.addgene.org/21894

Genetic Insert: EF1 alpha -miR26a GFP p(A)
Vector Backbone Description: Backbone Size:3952; Vector Backbone:pEMBL; Vector Types:Mammalian Expression, AAV, sc; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524505
Comments: miR-26a sequence is 5'-TTCAAGTAATCCAGGATAGGC Addgene sequencing results confirm the presence of both FseI sites flanking miR-26a.

Proper citation: RRID:Addgene_21894 Copy   

•   Source: Addgene

http://www.addgene.org/21949

Species: Homo sapiens
Genetic Insert: betaActin
Vector Backbone Description: Backbone Size:5802; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18512154

Proper citation: RRID:Addgene_21949 Copy   

•   Source: Addgene

http://www.addgene.org/21947

Species: jellyfish
Genetic Insert: mGFP-10-sREACh
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:3935; Vector Backbone:mGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18512154

Proper citation: RRID:Addgene_21947 Copy   

•   Source: Addgene

http://www.addgene.org/21917

Species: Homo sapiens
Genetic Insert: Full length human HKI in pGFP-N3
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18039843

Proper citation: RRID:Addgene_21917 Copy   

•   Source: Addgene

http://www.addgene.org/21914

Species: Mus musculus
Genetic Insert: CHOP
Vector Backbone Description: Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8650547
Comments: Addgene sequencing results show 6bp insertion in the sequencing adding 2 Gly residues immediately after the Myc tag. Mammalian expression plasmid encoding wildtype mouse CHOP fused to DNA-binding domain of yeast Gal4.

Proper citation: RRID:Addgene_21914 Copy   

•   Source: Addgene