Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 421 showing 8401 ~ 8420 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_13018

    This resource has 10+ mentions.

http://www.addgene.org/13018

Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 4
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Proper citation: RRID:Addgene_13018 Copy   


  • RRID:Addgene_13024

    This resource has 1+ mentions.

http://www.addgene.org/13024

Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 8
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Proper citation: RRID:Addgene_13024 Copy   


  • RRID:Addgene_13029

    This resource has 10+ mentions.

http://www.addgene.org/13029

Species: Homo sapiens
Genetic Insert: ELAM
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_13029 Copy   


  • RRID:Addgene_13054

    This resource has 1+ mentions.

http://www.addgene.org/13054

Species: Homo sapiens
Genetic Insert: hHR23B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1D V5 His TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15064742
Comments: You can cut out the hHR23B insert with HindIII and XhoI.

Proper citation: RRID:Addgene_13054 Copy   


  • RRID:Addgene_13037

    This resource has 1+ mentions.

http://www.addgene.org/13037

Species: Homo sapiens
Genetic Insert: Nucleolin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2897; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10760958

Proper citation: RRID:Addgene_13037 Copy   


  • RRID:Addgene_13038

http://www.addgene.org/13038

Species: Homo sapiens
Genetic Insert: GPX-1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7684384

Proper citation: RRID:Addgene_13038 Copy   


  • RRID:Addgene_130699

http://www.addgene.org/130699

Species: Homo sapiens
Genetic Insert: TPI-PTC1
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380

Proper citation: RRID:Addgene_130699 Copy   


  • RRID:Addgene_130697

    This resource has 1+ mentions.

http://www.addgene.org/130697

Species: Homo sapiens
Genetic Insert: TPI-Wildtype
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380

Proper citation: RRID:Addgene_130697 Copy   


http://www.addgene.org/130691

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130691 Copy   


http://www.addgene.org/130687

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-9.47A-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130687 Copy   


http://www.addgene.org/130684

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-11E.12D-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130684 Copy   


http://www.addgene.org/130682

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130682 Copy   


http://www.addgene.org/130683

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-10A.11D-14.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130683 Copy   


http://www.addgene.org/130680

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-36.47M-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130680 Copy   


http://www.addgene.org/130681

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-36
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130681 Copy   


http://www.addgene.org/130677

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-46.47A-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130677 Copy   


http://www.addgene.org/130678

Species: Homo sapiens
Genetic Insert: SMCHD1 Exon1-10A.12D-48
Vector Backbone Description: Backbone Size:7866; Vector Backbone:pLenti; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30071896

Proper citation: RRID:Addgene_130678 Copy   


  • RRID:Addgene_130672

http://www.addgene.org/130672

Species: Homo sapiens
Genetic Insert: KCNK4
Vector Backbone Description: Vector Backbone:pPICZ; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25500157

Proper citation: RRID:Addgene_130672 Copy   


  • RRID:Addgene_130703

http://www.addgene.org/130703

Species: Homo sapiens
Genetic Insert: 3 copies of human SUMO1 separated by (GGS)4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pC1-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_130703 Copy   


  • RRID:Addgene_130700

http://www.addgene.org/130700

Species: Homo sapiens
Genetic Insert: Beta Globin
Vector Backbone Description: Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31155380

Proper citation: RRID:Addgene_130700 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X