Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pKS070 - pCAGGS-3XFLAG-(human)CTCF-eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_156448 | human CTCF | Homo sapiens | Ampicillin | PMID:33154377 | This plasmid has been found to have dimerized. Plasmid dimerization often does not impact plasmid function, but may reduce transformation efficiencies. If you still need to isolate the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. | Vector Backbone:pKS070-pCAGGS-3XFLAG-(human)CTCF-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | none | 2026-08-29 12:57:56 | 3 |
|
pCAGGS-SARS2-S-G614 (C-flag) Resource Report Resource Website 1+ mentions |
RRID:Addgene_156421 | SARS-CoV-2 S protein | SARS CoV2 | Ampicillin | PMID:33243994 | Pseudotypes onto the MLV vector but not efficiently to VSV or lentiviral vectors | Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D614G | 2026-08-29 12:57:56 | 5 |
|
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE Resource Report Resource Website 1+ mentions |
RRID:Addgene_156430 | CTCF, rtta3G, TetO3G | Mus musculus | Ampicillin | PMID:33154377 | Vector Backbone:pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE.; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin | Cterm_Nterm_switched | 2026-08-29 12:57:56 | 1 | |
|
pBABE-puro LAP2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15712 | LAP2 | Homo sapiens | Ampicillin | PMID:16959612 | Human LAP2 was cloned by PCR from cDNA template and then digested with EcoR1/SalI and inserted in pBabe-Puro. | Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:58 | 6 | |
|
PRAS40 (mouse) shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_15672 | PRAS40 shRNA | Mus musculus | Ampicillin | PMID:17510057 | Oligonucleotides encoding the short-hairpin RNA expression cassette targeting mouse PRAS40 from base 753-773 (GI:124376717) were annealed and subcloned into pLKO.1. See author's map for shRNA sequence information. | Backbone Marker:Available at Addgene (#8453); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:57 | 1 | |
|
pCM433 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15670 | Chloramphenicol and Ampicillin | PMID:18710539 | Ampicillin, Chloramphenicol, Tetracycline | Backbone Size:8081; Vector Backbone:pCM433; Vector Types:bacterial allelic exchange vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 12:57:57 | 2 | |||
|
pRetroSuper-GFP TIF1gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_15721 | TIF1 gamma shRNA | Homo sapiens | Ampicillin | PMID:16751102 | shRNA oligos were first cloned into pRetrosuper-Puro digested with BglII and HindIII. Next, the AgeI/XhoI fragments from shRNA sequence-containing pRetrosuper-Puro plasmids were cloned into the AgeI/XhoI site of pRetrosuper-GFP. Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'. | Backbone Size:6000; Vector Backbone:pRetrosuper-GFP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:58 | 1 | |
|
pBABE YAP1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_15682 | YAP | Homo sapiens | Ampicillin | PMID:16894141 | The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC. | Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:57 | 17 | |
|
pRetroSuper TIF1gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_15728 | TIF1 gamma shRNA | Homo sapiens | Ampicillin | PMID:16751102 | shRNA oligos were cloned into pRetrosuper-Puro digested with BglII and HindIII. Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'. | Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:58 | 3 | |
|
MutaT7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_156460 | rApoI | Rattus norvegicus | Streptomycin | PMID:29991261 | Esherichia coli strain that expresses MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth MutaT7] | Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin | 2026-08-29 12:57:56 | 1 | |
|
pRetrosuper Myc shRNA Resource Report Resource Website 10+ mentions |
RRID:Addgene_15662 | Myc shRNA | Homo sapiens | Ampicillin | PMID:17558397 | hairpin targets the sequence: GATGAGGAAGAAATCGATG | Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:57 | 12 | |
|
pETM33_Nsp15 Resource Report Resource Website 1+ mentions |
RRID:Addgene_156481 | Nsp15 | Synthetic | Kanamycin | PMID:37704626 | insert amino acid sequence: GLQSLENVAFNVVNKGHFDGQQGEVPVSIINNTVYTKVDGVDVELFENKTTLPVNVAFELWAKRNIKPVPEVKILNNLGVDIAANTVIWDYKRDAPAHISTIGVCSMTDIAKKPTETICAPLTVFFDGRVDGQVDLFRNARNGVLITEGSVKGLQPSVGPKQASLNGVTLIGEAVKTQFNYYKKVDGVVQQLPETYFTQSRNLQEFKPRSQMEIDFLELAMDEFIERYKLEGYAFEHIVYGDFSHSQLGGLHLLIGLAKRFKESPFELEDFIPMDSTVKNYFITDAQTGSSKCVCSVIDLLLDDFVEIIKSQDLSVVSKVVKVTIDYTEISFMLWCKDGHVETFYPKLx | Backbone Size:6017; Vector Backbone:pETM33; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Gene insert is codon optimized for Ecoli. | 2026-08-29 12:57:57 | 1 |
|
pGEX TIF1gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_15734 | TIF1 gamma | Homo sapiens | Ampicillin | PMID:16751102 | Backbone Marker:Amersham; Backbone Size:4969; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:58 | 2 | ||
|
L3610 Resource Report Resource Website 1+ mentions |
RRID:Addgene_1575 | Ampicillin | See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.111, Ligation number L3610. | Backbone Size:4816; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:58 | 1 | ||||
|
pCAG-HA-LMW-FGF2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_157663 | Fibroblast growth factor 2 | Homo sapiens | Ampicillin | PMID:32383752 | Backbone Size:6377; Vector Backbone:pCAG-HA-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acid 1-134 | 2026-08-29 12:57:58 | 1 | |
|
pIND-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_15770 | mH2A.Z-EGFP | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pIND; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:59 | 4 | |||
|
pcDNA5-FRT-TO-Nsp5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_157685 | Nsp5 | SARS-CoV-2 | Ampicillin | PMID:33313418 | Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | codon optimized | 2026-08-29 12:57:59 | 1 | |
|
hChT pcDNA3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15766 | hemicholinium-3-sensitive choline transporter | Homo sapiens | Ampicillin | PMID:11027560 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:59 | 2 | ||
|
pGSTag Flag Jnk3a2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15748 | Jnk3a2 | Homo sapiens | Ampicillin | PMID:8654373 | Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:58 | 1 | ||
|
pGSTag Flag Jnk2a2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15744 | Jnk2a2 | Homo sapiens | Ampicillin | PMID:8654373 | Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:57:58 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
