Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: mouse IgH switch repeat region
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36476850
Proper citation: RRID:Addgene_134899 Copy
Species: Mus musculus
Genetic Insert: IL-10 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10657644
Proper citation: RRID:Addgene_24946 Copy
Species: Mus musculus
Genetic Insert: IL-10 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10657644
Comments: T->C mutation at -253; should not affect function
Proper citation: RRID:Addgene_24945 Copy
Species: Mus musculus
Genetic Insert: IL-10 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10657644
Comments: G->C mutation at -4; should not affect function.
Proper citation: RRID:Addgene_24947 Copy
Species: Mus musculus
Genetic Insert: IL-10 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10657644
Proper citation: RRID:Addgene_24943 Copy
Species: Mus musculus
Genetic Insert: TSC2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCMV; Vector Types:N/A; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_24940 Copy
Species: Mus musculus
Genetic Insert: Axin1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:MSCV hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20368440
Proper citation: RRID:Addgene_24928 Copy
Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:7000; Vector Backbone:MSCV hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20368440
Proper citation: RRID:Addgene_24926 Copy
Species: Mus musculus
Genetic Insert: Irx5
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCMV5b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16239150
Comments: HA tag is YDVPDYASL.
Proper citation: RRID:Addgene_24997 Copy
Species: Mus musculus
Genetic Insert: Irx5
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCMV5b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16239150
Comments: HA tag is YDVPDYASL.
Proper citation: RRID:Addgene_24996 Copy
Species: Mus musculus
Genetic Insert: Irx5
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCMV5b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16239150
Comments: HA tag is YDVPDYASL.
Proper citation: RRID:Addgene_24995 Copy
Species: Mus musculus
Genetic Insert: mMCL1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25385 Copy
Species: Mus musculus
Genetic Insert: mMCL1(S140A)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25387 Copy
Species: Mus musculus
Genetic Insert: mMCL1(S140A)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25383 Copy
Species: Mus musculus
Genetic Insert: mMCL1(T144A)
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25382 Copy
Species: Mus musculus
Genetic Insert: high mobility group AT-Hook 2
Vector Backbone Description: Backbone Marker:Elledge lab, Addgene plasmid 11663; Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP-FF3; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:18957199
Comments: pPRIME-CMV-GFP-FF3 is available from Addgene.
HMGA2 shRNA sequence:
TGCTGTTGACAGTGAGCGATTTGTGGATCTGATAAGCAAGTAGTGAAGCCACAGATGTACTTGCTTATCAGATCCACAAACTGCCTACTGCCTCGGA
Proper citation: RRID:Addgene_25408 Copy
Species: Mus musculus
Genetic Insert: high mobility group AT-Hook 2
Vector Backbone Description: Backbone Marker:Gift from David Baltimore; Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral, ChIP; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18957199
Proper citation: RRID:Addgene_25409 Copy
Species: Mus musculus
Genetic Insert: 24p3/lipocalin 2 proximal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15591425
Proper citation: RRID:Addgene_25463 Copy
Species: Mus musculus
Genetic Insert: mouse Smoothened cDNA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12414725
Proper citation: RRID:Addgene_25395 Copy
Species: Mus musculus
Genetic Insert: diaph1
Vector Backbone Description: Backbone Marker:clontech Invitrogen; Backbone Size:4700; Vector Backbone:YFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17198702
Comments: Also see Copeland, J. W., and R. Treisman. 2002. The Diaphanous-related Formin mDia1 Controls Serum Response Factor Activity through its Effects on Actin Polymerization. Mol Biol Cell 13:4088-99 for information about FH2∆N2 mutation.
Proper citation: RRID:Addgene_25419 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
