Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: CHOP10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline
Comments: From depositing lab:
"9E10 (Myc-epitope) tagged mouse CHOP coding region only. The insert was joined to the epitope tag using patch-PCR and incorporating unique BamH1 and Xho1 sites for ligation into pcDNA1. Stocks are provided as MC1060 (or MC1061, we are not sure) host strain transformed with the plasmid. Note that pCDNA1 plasmids must be propagated on combined amp and tet selection. I would recommedn that you consider transferring the insert into a better host strain such as pcDNA3"
Proper citation: RRID:Addgene_21913 Copy
Species: Homo sapiens
Genetic Insert: Mutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18039843
Proper citation: RRID:Addgene_21922 Copy
Species: Homo sapiens
Genetic Insert: hnRNPF
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4700; Vector Backbone:p3xFLAG-CMV-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18573884
Proper citation: RRID:Addgene_21926 Copy
Species: Homo sapiens
Genetic Insert: PA-Rac1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt.
Proper citation: RRID:Addgene_22027 Copy
Species: Homo sapiens
Genetic Insert: PA-Rac1-C450A
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt.
Proper citation: RRID:Addgene_22021 Copy
Species: Mus musculus
Genetic Insert: Oct4i
Vector Backbone Description: Backbone Size:7558; Vector Backbone:pSicoR; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19587682
Comments: Oct4 RNAi sequence 5'-GAACCTGGCTAAGCTTCCA
Proper citation: RRID:Addgene_21906 Copy
Species: Mus musculus
Genetic Insert: CHOP
Vector Backbone Description: Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: 9E10 (Myc-epitope) tagged mouse CHOP coding region only, S78A and S81A double mutant. The S78A and S81A mutation introduces an additional HhaI site not present in the wildtype insert. Note that there is considerable uncertainity regarding this plasmid.
Proper citation: RRID:Addgene_21902 Copy
Species: Homo sapiens
Genetic Insert: NFkB p65 subunit
Vector Backbone Description: Backbone Marker:Matthias P et al. Nucleic Acids Research (1989). 17(15): 6418; Backbone Size:5120; Vector Backbone:pEv3s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11533489
Proper citation: RRID:Addgene_21984 Copy
Species: Mus musculus
Genetic Insert: Sprouty 2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10498682
Comments: mSprouty cDNA clone was isolated from a mouse E11 cDNA library (Clonetech). The entire coding region as well as 5' and 3' UTR sequences are included.
For antisense probe, linearize the plasmid with SacII and use T3 Polymerase. The transcript should be approximately 1.5kb.
Proper citation: RRID:Addgene_22097 Copy
Genetic Insert: synthethic oligonucleotide
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:7394; Vector Backbone:pSUPER_Retro-GFP/Neo; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17526729
Comments: shRNA oligo sequence - 5'-GATCCCCGACAAGGTCTGCAAAGGGTTTCAAGAGAACCCTTTGCAGACCTTGTCTTTTT
Proper citation: RRID:Addgene_22131 Copy
Genetic Insert: synthethic oligonucleotide
Vector Backbone Description: Backbone Marker:NKI-AVL; Backbone Size:6349; Vector Backbone:pRetro-Super; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14691554
Proper citation: RRID:Addgene_22100 Copy
Genetic Insert: synthethic oligonucleotide
Vector Backbone Description: Backbone Marker:NKI-AVL; Backbone Size:6349; Vector Backbone:pRetro-Super; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14691554
Proper citation: RRID:Addgene_22101 Copy
Species: Homo sapiens
Genetic Insert: tumor protein p73
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5352; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9296498
Proper citation: RRID:Addgene_22102 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18599482
Proper citation: RRID:Addgene_22117 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18599482
Proper citation: RRID:Addgene_22113 Copy
Species: Homo sapiens
Genetic Insert: TETO-eGFP
Vector Backbone Description: Backbone Size:6885; Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19680244
Proper citation: RRID:Addgene_22074 Copy
Species: Homo sapiens
Genetic Insert: SA-Puro
Vector Backbone Description: Backbone Size:5890; Vector Backbone:N/A; Vector Types:ZFN donor; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19680244
Comments: Please note that this plasmid contains a non-functional ccdB gene. The use of ccdB survival cells may be needed when subcloning or modifying this vector if the number of transformants is low.
Proper citation: RRID:Addgene_22075 Copy
Species: C. reinhardtii
Genetic Insert: ChR2-GFP
Vector Backbone Description: Backbone Marker:Lois/Baltimore; Backbone Size:9115; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16116447
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER NOVEL REAGENTS IN THIS LINE.
Proper citation: RRID:Addgene_22051 Copy
Species: Herpes Simplex Type 1
Genetic Insert: HSV Type 1 thymidine kinase
Vector Backbone Description: Backbone Size:8294; Vector Backbone:pAL120; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18287240
Proper citation: RRID:Addgene_22053 Copy
Species: Homo sapiens
Genetic Insert: TFII-I
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10854432
Comments: The internal restriction sites may not be correct
Proper citation: RRID:Addgene_22148 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
