Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,972 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pUC19-Mu-switch-R-loop
 
Resource Report
Resource Website 		RRID:Addgene_134899 mouse IgH switch repeat region Mus musculus Ampicillin PMID:36476850 Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-29 01:15:37 0
pGL2B -158/+64
 
Resource Report
Resource Website 		RRID:Addgene_24946 IL-10 promoter Mus musculus Ampicillin PMID:10657644 Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:02:35 0
pGL2B -376/+64
 
Resource Report
Resource Website 		RRID:Addgene_24945 IL-10 promoter Mus musculus Ampicillin PMID:10657644 T->C mutation at -253; should not affect function Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:02:35 0
pGL2B -78/+64
 
Resource Report
Resource Website 		RRID:Addgene_24947 IL-10 promoter Mus musculus Ampicillin PMID:10657644 G->C mutation at -4; should not affect function. Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:02:35 0
pGL2B -938/+64
 
Resource Report
Resource Website 		RRID:Addgene_24943 IL-10 promoter Mus musculus Ampicillin PMID:10657644 Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-29 01:02:35 0
TSC2-fl
 
Resource Report
Resource Website 		RRID:Addgene_24940 TSC2 Mus musculus Ampicillin Backbone Size:0; Vector Backbone:pCMV; Vector Types:N/A; Bacterial Resistance:Ampicillin 2026-08-29 01:02:35 0
MSCVhyg-F-Axin1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24928 Axin1 Mus musculus Ampicillin PMID:20368440 Backbone Size:7000; Vector Backbone:MSCV hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:02:35 2
MSCVhygro-F-Ezh2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24926 Ezh2 Mus musculus Ampicillin PMID:20368440 Backbone Size:7000; Vector Backbone:MSCV hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:02:34 5
pCMV5b HA Irx5 deltaHD
 
Resource Report
Resource Website 		RRID:Addgene_24997 Irx5 Mus musculus Ampicillin PMID:16239150 HA tag is YDVPDYASL. Backbone Size:0; Vector Backbone:pCMV5b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletes entire HD (aa 112-177) 2026-08-29 01:02:35 0
pCMV5b HA Irx5 deltaC
 
Resource Report
Resource Website 		RRID:Addgene_24996 Irx5 Mus musculus Ampicillin PMID:16239150 HA tag is YDVPDYASL. Backbone Size:0; Vector Backbone:pCMV5b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletes everything after Hox Domain (aa 112-177). Contains aa 1-177 2026-08-29 01:02:35 0
pCMV5b HA Irx5 deltaIrot
 
Resource Report
Resource Website 		RRID:Addgene_24995 Irx5 Mus musculus Ampicillin PMID:16239150 HA tag is YDVPDYASL. Backbone Size:0; Vector Backbone:pCMV5b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletion of Iro box (aa 314-327), 19 aa upstream of Iro box, and all downstream of Iro box. Contains aa 1-313. 2026-08-29 01:02:35 0
pBabe-HA-mMcl-1
 
Resource Report
Resource Website 		RRID:Addgene_25385 mMCL1 Mus musculus Ampicillin PMID:19433446 Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:02:39 0
pBabe-HA-mMcl-1(S140A)
 
Resource Report
Resource Website 		RRID:Addgene_25387 mMCL1(S140A) Mus musculus Ampicillin PMID:19433446 Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin changed serine 140 to alanine 2026-08-29 01:02:39 0
pCDNA3-HA-mMcl1(S140A)
 
Resource Report
Resource Website 		RRID:Addgene_25383 mMCL1(S140A) Mus musculus Ampicillin PMID:19433446 Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed serine 140 to alanine 2026-08-29 01:02:39 0
pGEX4T-1-mMcl-1(T144A)
 
Resource Report
Resource Website 		RRID:Addgene_25382 mMCL1(T144A) Mus musculus Ampicillin PMID:19433446 Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin changed threonine 144 to alanine 2026-08-29 01:02:39 0
HMGA2 shRNA
 
Resource Report
Resource Website 		RRID:Addgene_25408 high mobility group AT-Hook 2 Mus musculus Chloramphenicol PMID:18957199 pPRIME-CMV-GFP-FF3 is available from Addgene. HMGA2 shRNA sequence: TGCTGTTGACAGTGAGCGATTTGTGGATCTGATAAGCAAGTAGTGAAGCCACAGATGTACTTGCTTATCAGATCCACAAACTGCCTACTGCCTCGGA Backbone Marker:Elledge lab, Addgene plasmid 11663; Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP-FF3; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol None 2026-08-29 01:02:39 0
HMGA2-FLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25409 high mobility group AT-Hook 2 Mus musculus Ampicillin PMID:18957199 Backbone Marker:Gift from David Baltimore; Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral, ChIP; Bacterial Resistance:Ampicillin None 2026-08-29 01:02:39 2
pGL3-24p3/LCN2-Luc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25463 24p3/lipocalin 2 proximal promoter Mus musculus Ampicillin PMID:15591425 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin none 2026-08-29 01:02:39 2
pEGFP-mSmo
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_25395 mouse Smoothened cDNA Mus musculus Kanamycin PMID:12414725 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:02:39 13
YFP-mDia1FH2deltaN
 
Resource Report
Resource Website 		RRID:Addgene_25419 diaph1 Mus musculus Kanamycin PMID:17198702 Also see Copeland, J. W., and R. Treisman. 2002. The Diaphanous-related Formin mDia1 Controls Serum Response Factor Activity through its Effects on Actin Polymerization. Mol Biol Cell 13:4088-99 for information about FH2∆N2 mutation. Backbone Marker:clontech Invitrogen; Backbone Size:4700; Vector Backbone:YFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin mDia1 FH2∆N2 sequence (encodes amino acids 771-1182) 2026-08-29 01:02:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch