Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Diap3
Vector Backbone Description: Backbone Size:3000; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11035012
Comments: The Q1091P mutation in the DAD region was not intentional and may have been a cloning error.
Proper citation: RRID:Addgene_25410 Copy
Species: Mus musculus
Genetic Insert: Pax3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4400; Vector Backbone:pCMV-Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25426 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Proper citation: RRID:Addgene_25758 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP
Proper citation: RRID:Addgene_25766 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites.
Proper citation: RRID:Addgene_25761 Copy
Species: Mus musculus
Genetic Insert: Gli3
Vector Backbone Description: Backbone Size:2958; Vector Backbone:pBluescript II (KS); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8387379
Comments: Insert containing the entire ZnF domain
Proper citation: RRID:Addgene_25733 Copy
Species: Mus musculus
Genetic Insert: Gb2
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12486; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Neo with TRE-driven G beta 2 miR-shRNA
G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25744 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Proper citation: RRID:Addgene_25741 Copy
Species: Mus musculus
Genetic Insert: mMCL1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25714 Copy
Species: Mus musculus
Genetic Insert: Wnt10b / b-globin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15190075
Proper citation: RRID:Addgene_25877 Copy
Species: Mus musculus
Genetic Insert: Wnt10b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Comments: See attached map for details.
The entire OCN-Wnt10b-b-globin product can be excised with HindIII/XhoI for a ~6.1 kB fragment
Proper citation: RRID:Addgene_25878 Copy
Species: Mus musculus
Genetic Insert: RapR-FAK
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581846
Proper citation: RRID:Addgene_25927 Copy
Species: Mus musculus
Genetic Insert: RapR-FAK
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581846
Proper citation: RRID:Addgene_25926 Copy
Species: Mus musculus
Genetic Insert: p18 C/EBPalpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11340085
Comments: To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site.
p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa.
Proper citation: RRID:Addgene_25881 Copy
Species: Mus musculus
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371338
Comments: This plasmid targets the open reading frame of p21. The 19mer target sequence is: AGTAGCAGTTGTACAAGGA
Proper citation: RRID:Addgene_25869 Copy
Species: Mus musculus
Genetic Insert: Gq alpha
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline
Defining Citation: PMID:8387644
Comments: This is Gq alpha with the C-terminal amino acids changed from Gq alpha to Gz alpha residues (EYNLV to YIGLC). Works the same as qi5 and is the least popular since no one knows what Gz alpha really does in nature. Since qz5 is not sensitive to pertussis toxin, qz5 may be the only G protein activated by a Gi-coupled receptor in cells treated with pertussis toxin. This trick can be experimentally useful in settings where you want experimental control of the exact G protein and the receptor that is activated. It is theoretically possible that this construct will work better than the other constructs for particular receptors, but the Conklin lab has not seen this happen yet.
Contains an internal hemaglutinin epitope tag (DVPDYA) that has no effect on receptor coupling.
Please see supplemental document for G-protein chimera user manual.
Proper citation: RRID:Addgene_25867 Copy
Species: Mus musculus
Genetic Insert: Gata3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2997; Vector Backbone:pGEM-7zf(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2017177
Proper citation: RRID:Addgene_25796 Copy
Species: Mus musculus
Genetic Insert: Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc
Vector Backbone Description: Backbone Size:10600; Vector Backbone:mCol.loxneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20010831
Proper citation: RRID:Addgene_25794 Copy
Species: Mus musculus
Genetic Insert: twisted gastrulation
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Xenopus chordin signal peptide N-epitope. Will homo-dimerize, binds covalently to Chordin and is recognized by R&D monoclonal anti-TSG antibody MAB756. Prevents the making of Ternary complex as published in Oelgeschlager M, et al., 2003b. Purified protein is readily ventralizing when injected in blastocoel.
Proper citation: RRID:Addgene_25778 Copy
Species: Mus musculus
Genetic Insert: cross veinless 2
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14516682
Comments: For sense, linearize with NotI, transcribe with SP6.
Protein C Epitope tag sequence - EDQVDPRLIDGK
Proper citation: RRID:Addgene_25776 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
