Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEGFPm-DAD Resource Report Resource Website 1+ mentions |
RRID:Addgene_25410 | Diap3 | Mus musculus | Ampicillin | PMID:11035012 | The Q1091P mutation in the DAD region was not intentional and may have been a cloning error. | Backbone Size:3000; Vector Backbone:EF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | mDia2 Amino Acids 1031-1171; Q1091P mutation | 2026-08-29 01:02:39 | 1 |
|
pCMVSport6/mPax3 Resource Report Resource Website |
RRID:Addgene_25426 | Pax3 | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4400; Vector Backbone:pCMV-Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:39 | 0 | |||
|
pEN_hU6miR-G13-L Resource Report Resource Website |
RRID:Addgene_25758 | G alpha 13 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with U6-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT | Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 0 | |
|
pEN_TGmiR_Gb2-K Resource Report Resource Website |
RRID:Addgene_25766 | Gb2 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP | Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:53 | 0 | |
|
pEN_TmiR_G12-E Resource Report Resource Website |
RRID:Addgene_25761 | G alpha 12 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 0 | |
|
pGli3a Resource Report Resource Website 1+ mentions |
RRID:Addgene_25733 | Gli3 | Mus musculus | Ampicillin | PMID:8387379 | Insert containing the entire ZnF domain | Backbone Size:2958; Vector Backbone:pBluescript II (KS); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:52 | 1 | |
|
pSLIK-Neo-TmiR-Gb2 Resource Report Resource Website |
RRID:Addgene_25744 | Gb2 | Mus musculus | Ampicillin | PMID:16945906 | pSLIK-Neo with TRE-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA | Backbone Marker:Iain Fraser; Backbone Size:12486; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:52 | 0 | |
|
pSLIK-Venus-TmiR-G13 Resource Report Resource Website |
RRID:Addgene_25741 | G alpha 13 miR-shRNA | Mus musculus | Ampicillin | PMID:16945906 | pSLIK-Venus with G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT | Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:52 | 0 | |
|
pCDNA3-HA-mMcl1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25714 | mMCL1 | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:52 | 1 | ||
|
(G38) pCRII-Wnt10b/b-globin Resource Report Resource Website |
RRID:Addgene_25877 | Wnt10b / b-globin | Mus musculus | Ampicillin | PMID:15190075 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | ||
|
(P79) OCN/Wnt 10b transgene Resource Report Resource Website |
RRID:Addgene_25878 | Wnt10b | Mus musculus | Ampicillin | See attached map for details. The entire OCN-Wnt10b-b-globin product can be excised with HindIII/XhoI for a ~6.1 kB fragment | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | ||
|
myc-Rapr-FAK-YM Resource Report Resource Website 1+ mentions |
RRID:Addgene_25927 | RapR-FAK | Mus musculus | Ampicillin | PMID:20581846 | Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | This myc-RapR-FAK-YM plasmid contains FAK mutations Y180A and M183A. (The sequence data uploaded to addgene is based on wt). | 2026-08-29 01:02:54 | 1 | |
|
myc-Rapr-FAK Resource Report Resource Website 1+ mentions |
RRID:Addgene_25926 | RapR-FAK | Mus musculus | Ampicillin | PMID:20581846 | Backbone Size:5500; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:54 | 1 | ||
|
(E6) CMV-p18 C/EBPalpha Resource Report Resource Website |
RRID:Addgene_25881 | p18 C/EBPalpha | Mus musculus | Ampicillin | PMID:11340085 | To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site. p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N-terminal truncation, contains only CR4 and bZIP domains. | 2026-08-29 01:02:53 | 0 |
|
p21 shRNA2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25869 | p21 | Mus musculus | Ampicillin | PMID:18371338 | This plasmid targets the open reading frame of p21. The 19mer target sequence is: AGTAGCAGTTGTACAAGGA | Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 1 | |
|
qz5 Resource Report Resource Website |
RRID:Addgene_25867 | Gq alpha | Mus musculus | Ampicillin and Tetracycline | PMID:8387644 | This is Gq alpha with the C-terminal amino acids changed from Gq alpha to Gz alpha residues (EYNLV to YIGLC). Works the same as qi5 and is the least popular since no one knows what Gz alpha really does in nature. Since qz5 is not sensitive to pertussis toxin, qz5 may be the only G protein activated by a Gi-coupled receptor in cells treated with pertussis toxin. This trick can be experimentally useful in settings where you want experimental control of the exact G protein and the receptor that is activated. It is theoretically possible that this construct will work better than the other constructs for particular receptors, but the Conklin lab has not seen this happen yet. Contains an internal hemaglutinin epitope tag (DVPDYA) that has no effect on receptor coupling. Please see supplemental document for G-protein chimera user manual. | Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline | Replacement of the five carboxyl-terminal amino acids of Gq alpha (EYNLV) with those of Gz alpha(YIGLC) | 2026-08-29 01:02:53 | 0 |
|
pGEM mGata3 Resource Report Resource Website |
RRID:Addgene_25796 | Gata3 | Mus musculus | Ampicillin | PMID:2017177 | Backbone Marker:Promega; Backbone Size:2997; Vector Backbone:pGEM-7zf(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | ||
|
mCol.4F2A targeting construct Resource Report Resource Website 1+ mentions |
RRID:Addgene_25794 | Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc | Mus musculus | Ampicillin | PMID:20010831 | Backbone Size:10600; Vector Backbone:mCol.loxneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 1 | ||
|
pCS2 mouse twisted gastrulation Resource Report Resource Website 1+ mentions |
RRID:Addgene_25778 | twisted gastrulation | Mus musculus | Ampicillin | Xenopus chordin signal peptide N-epitope. Will homo-dimerize, binds covalently to Chordin and is recognized by R&D monoclonal anti-TSG antibody MAB756. Prevents the making of Ternary complex as published in Oelgeschlager M, et al., 2003b. Purified protein is readily ventralizing when injected in blastocoel. | Backbone Marker:Stratagene; Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 1 | ||
|
pCS2 mouse CV2 PC Resource Report Resource Website 1+ mentions |
RRID:Addgene_25776 | cross veinless 2 | Mus musculus | Ampicillin | PMID:14516682 | For sense, linearize with NotI, transcribe with SP6. Protein C Epitope tag sequence - EDQVDPRLIDGK | Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
