Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: CRE
Vector Backbone Description: Backbone Size:10785; Vector Backbone:AAVS1-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33765444
Proper citation: RRID:Addgene_165457 Copy
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2710; Vector Backbone:pUC19; Vector Types:Bacterial vector for DNA production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33590100
Comments: Please cite the following article in any publications where this construct is utilized:
doi: 10.1093/nar/gkab070
Z. Adhireksan, D. Sharma, P.L. Lee, Q. Bao, S. Padavattan, W.K. Shum, G.E. Davey & C.A. Davey. (2021). Engineering Nucleosomes for Generating Diverse Chromatin Assemblies. Nucleic Acids Res.
Proper citation: RRID:Addgene_165455 Copy
Genetic Insert: Mammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
Vector Backbone Description: Backbone Marker:Joung Lab (Addgene Plasmid #65771); Vector Backbone:MSP469; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33441553
Proper citation: RRID:Addgene_165486 Copy
Species: Synthetic
Genetic Insert: Venus-bPAC(F198Y)-myc
Vector Backbone Description: Backbone Size:3100; Vector Backbone:pGEM HE; Vector Types:Bacterial Expression, cDNA expression, Xenopus Oocyte; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34663304
Proper citation: RRID:Addgene_165487 Copy
Species: Synthetic
Genetic Insert: Zebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
Vector Backbone Description: Backbone Marker:Eric Kowarz Lab (Addgene #60511); Backbone Size:6640; Vector Backbone:pSBbi-GP; Vector Types:CRISPR, Transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33846462
Proper citation: RRID:Addgene_165484 Copy
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pTriEx-1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24510647
Comments: Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add GATTGGAAGTAGAGGTTCTCTGC to the 3' end of GOI. For vector: digest with BfuAI (BspMI) before LIC-treatment. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
Proper citation: RRID:Addgene_165480 Copy
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pTriEx-1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24510647
Comments: Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add GATTGGAAGTAGAGGTTCTCTGC to the 3' end of GOI. For vector: digest with BfuAI (BspMI) before LIC-treatment. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
Proper citation: RRID:Addgene_165481 Copy
Species: Homo sapiens
Genetic Insert: Membrane bound O-acyltransferase domain containing 7
Vector Backbone Description: Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21903422
Comments: Backbone contains new MCS (multiple cloning site). CDS without stop codon was inserted with XhoI-NotI and it expresses in frame with 3xFLAG epitope tag. Construct insertion = Xhoi-GCC-[MBOAT7 CDS 1416 bp, no stop]-Noti-A-Clai-GTCGAG-3xFLAG-STOP
Proper citation: RRID:Addgene_165474 Copy
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET23; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24510647
Comments: Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add TGAAAATAGAGGTTTTCGGC to the 3' end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
Proper citation: RRID:Addgene_165477 Copy
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET23; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24510647
Comments: Primers for LIC cloning: Upstream: add TATTTTCAATCCTACGTA to the 5' end of gene of interest. Downstream: add CCCTCAATATTATACGGG to the 3' end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
Proper citation: RRID:Addgene_165478 Copy
Species: Homo sapiens
Genetic Insert: Adenosine deaminase RNA specific B2 (inactive)
Vector Backbone Description: Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24778252
Comments: Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site.
Proper citation: RRID:Addgene_165470 Copy
Species: Mus musculus
Genetic Insert: Mettl3 C-terminus + linker + FKBP-V
Vector Backbone Description: Vector Backbone:None; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34131006
Proper citation: RRID:Addgene_165421 Copy
Species: Homo sapiens
Genetic Insert: PPAR gamma
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10555149
Comments: Note that there are some discrepancies between the insert in this plasmid and the canonical GenBank PPARgamma. The Vogelstein lab maintains that this plasmid worked as specified when they made and used it.
Proper citation: RRID:Addgene_16549 Copy
Species: Homo sapiens
Genetic Insert: gRNA against PGC-1a variant 1
Vector Backbone Description: Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33626346
Proper citation: RRID:Addgene_165425 Copy
Vector Backbone Description: Backbone Size:5210; Vector Backbone:pBI-MCS-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10588737
Comments: The tet-responsive reporter plasmid pBI-EGFP was purchased from Clontech and modified by the inclusion of a polylinker to create pBI-MCS-EGFP.
Proper citation: RRID:Addgene_16542 Copy
Species: Homo sapiens
Genetic Insert: gRNA against human Total PGC-1a variants
Vector Backbone Description: Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33626346
Proper citation: RRID:Addgene_165426 Copy
Species: Rattus norvegicus
Genetic Insert: iGluSnFR extracellular domain fused to TARP gamma-8 via NETO2 TM domain
Vector Backbone Description: Backbone Size:3950; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36622100
Comments: Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-8
pAAV backbone is based on Addgene plasmid # 61463
Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.
Proper citation: RRID:Addgene_165498 Copy
Species: Synthetic
Genetic Insert: CT81 gene circuit
Vector Backbone Description: Backbone Size:9311; Vector Backbone:pMMB206; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33558556
Comments: pMMB206 backbone is very low copy, <10 copies.
Proper citation: RRID:Addgene_165411 Copy
Species: Synthetic
Genetic Insert: Glyco-Venus-bPAC(S27A)-Myc
Vector Backbone Description: Backbone Size:3009; Vector Backbone:pGEM HE; Vector Types:Bacterial Expression, cDNA expression, Xenopus Oocyte; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34663304
Proper citation: RRID:Addgene_165490 Copy
Species: Homo sapiens
Genetic Insert: PPAR alpha
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10555149
Proper citation: RRID:Addgene_16550 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.