Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: KGA glutaminase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22228304
Proper citation: RRID:Addgene_110332 Copy
Species: Homo sapiens
Genetic Insert: B3GNT5
Vector Backbone Description: Backbone Marker:#85208; Backbone Size:7032; Vector Backbone:pLKO.1-TRC.mKO2; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29115931
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110325 Copy
Species: Homo sapiens
Genetic Insert: HRASLS
Vector Backbone Description: Backbone Marker:#85208; Backbone Size:7032; Vector Backbone:pLKO.1-TRC.mKO2; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29115931
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110324 Copy
Species: Homo sapiens
Genetic Insert: KGA glutaminase
Vector Backbone Description: Backbone Marker:#110344; Backbone Size:7423; Vector Backbone:pQC MCS IRES G418; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: KGA.wt obtained with V5-6xHis from pcDNA3.1D V5-His-TOPO-KGA.wt (Addgene #110332)
pQC-based γ-Retroviral transfer vector for KGA.wt-V5 expression. IRES-driven Puromycin selection.
Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.
Proper citation: RRID:Addgene_110390 Copy
Species: Homo sapiens
Genetic Insert: ELAV like RNA binding protein 1
Vector Backbone Description: Backbone Marker:#110341; Backbone Size:7757; Vector Backbone:pQC V5 mKO2 MCS IRES Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: pQC-based γ-Retroviral transfer vector for V5-mKO2-HuR.wt expression. IRES-driven Puromycin selection.
Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.
Proper citation: RRID:Addgene_110387 Copy
Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:#26655; Backbone Size:6783; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110420 Copy
Species: Homo sapiens
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:#21915; Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110421 Copy
Species: Homo sapiens
Genetic Insert: ELAV like RNA binding protein 1
Vector Backbone Description: Backbone Marker:#110342; Backbone Size:7064; Vector Backbone:pQC V5 MCS IRES Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: pQC-based γ-Retroviral transfer vector for V5-HuR.wt expression. IRES-driven Puromycin selection.
Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.
Proper citation: RRID:Addgene_110386 Copy
Species: Homo sapiens
Genetic Insert: ELAVL1 HuR
Vector Backbone Description: Backbone Marker:#85208; Backbone Size:7032; Vector Backbone:pLKO.1-TRC.mKO2; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110426 Copy
Species: Homo sapiens
Genetic Insert: ELAV like RNA binding protein 1
Vector Backbone Description: Backbone Marker:#110371; Backbone Size:5834; Vector Backbone:pcDNA5/FRT/TO/FLAG-mKO2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Insert created by joining regions before (Addgene #110395) and after (Addgene #110395) HuR HNS by HindIII restriction site
Proper citation: RRID:Addgene_110373 Copy
Species: Homo sapiens
Genetic Insert: Neurogenin 2
Vector Backbone Description: Backbone Marker:custom; Backbone Size:6000; Vector Backbone:pUCM; Vector Types:Mammalian Expression, Cre/Lox, CRISPR, TALEN; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_110492 Copy
Species: Homo sapiens
Genetic Insert: Yes
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_110497 Copy
Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:#26655; Backbone Size:6783; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110410 Copy
Species: Homo sapiens
Genetic Insert: ELAVL1 (HuR)
Vector Backbone Description: Backbone Marker:#21915; Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110411 Copy
Species: Homo sapiens
Genetic Insert: ELAVL1 (HuR)
Vector Backbone Description: Backbone Marker:#21915; Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110412 Copy
Species: Homo sapiens
Genetic Insert: HuR (ELAVL1)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_110417 Copy
Species: Homo sapiens
Genetic Insert: HRPT2 136X
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGCTATGCTTCTGCTAAAACTTC 3' and ligated into pcDNA3 HRPT2 that had been digested with BamHI & XhoI (which removes full-length HRPT2, but leaves the flag tag at the N-terminus. See plasmid 11048 to learn how pcDNA3 HRPT2 was constructed).
Proper citation: RRID:Addgene_11049 Copy
Species: Homo sapiens
Genetic Insert: HRPT2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGAATTCGGATCCACCATGGATTACAAGGATGACGACGATAAGGTCGACATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGTCAGAATCTCAAGTGCGATTTATGCTT 3'
Proper citation: RRID:Addgene_11048 Copy
Species: Homo sapiens
Genetic Insert: SOX4
Vector Backbone Description: Backbone Marker:William Sellers; Vector Backbone:pcDNA3-Flag-FKHR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16618720
Proper citation: RRID:Addgene_110360 Copy
Species: Homo sapiens
Genetic Insert: HOXC6
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3-HISA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15637592
Proper citation: RRID:Addgene_110365 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.