Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 426 showing 8501 ~ 8520 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_110366

http://www.addgene.org/110366

Species: Homo sapiens
Genetic Insert: HOXC6
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3-HISA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15637592

Proper citation: RRID:Addgene_110366 Copy   


  • RRID:Addgene_110401

    This resource has 1+ mentions.

http://www.addgene.org/110401

Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6278; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_110401 Copy   


http://www.addgene.org/110406

Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:#50005; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Comments: Homology arm for C-Terminal knock-in at stop codon of GLS' KGA isoform. Just mKO2 knock-in. Construction order: GLS 1kb 5' Homology Arm: SacI-BamHI; GLS 1kb 3' Homology Arm BamHI-SalI; BglII-BamHI mKO2 System options: sgRNA: pX330.puro sgRNA KGA Stop1 (Addgene #110405) Homology arms: pUC19 KGA HA5'-mKO2-3' (Addgene #110406) pUC19 KGA HA5'-mKO2-P2A-3' (Addgene #110407) pUC19 KGA HA5'-mKO2-P2A-Zeo-3' (Addgene #110408)

Proper citation: RRID:Addgene_110406 Copy   


http://www.addgene.org/110405

Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:#110403; Backbone Size:9906; Vector Backbone:pX330.puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: sgRNA for GLS exon 19 (KGA isoform stop codon), intended to perform C-Terminal knock-in using pX330 with puromycin resistance. System options: sgRNA: pX330.puro sgRNA KGA Stop1 (Addgene #110405) Homology arms: pUC19 KGA HA5'-mKO2-3' (Addgene #110406) pUC19 KGA HA5'-mKO2-P2A-3' (Addgene #110407) pUC19 KGA HA5'-mKO2-P2A-Zeo-3' (Addgene #110408)

Proper citation: RRID:Addgene_110405 Copy   


  • RRID:Addgene_110512

http://www.addgene.org/110512

Species: Homo sapiens
Genetic Insert: PKCZ
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_110512 Copy   


  • RRID:Addgene_110510

http://www.addgene.org/110510

Species: Homo sapiens
Genetic Insert: PLEKHS1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_110510 Copy   


  • RRID:Addgene_110357

http://www.addgene.org/110357

Species: Homo sapiens
Genetic Insert: KGA glutaminase
Vector Backbone Description: Backbone Marker:#1766; Backbone Size:4902; Vector Backbone:pBABE-zeo (pBABE-bleo); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.

Proper citation: RRID:Addgene_110357 Copy   


http://www.addgene.org/110465

Species: Homo sapiens
Genetic Insert: NDP52
Vector Backbone Description: Backbone Size:5747; Vector Backbone:pBMN-mEGFP-C1; Vector Types:Mammalian Expression, Retroviral, retrovirus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26266977

Proper citation: RRID:Addgene_110465 Copy   


http://www.addgene.org/110346

Species: Homo sapiens
Genetic Insert: ELAV like RNA binding protein 1
Vector Backbone Description: Backbone Marker:Plasmid #1764; Backbone Size:5177; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.

Proper citation: RRID:Addgene_110346 Copy   


  • RRID:Addgene_110500

http://www.addgene.org/110500

Species: Homo sapiens
Genetic Insert: Rab13
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22674975

Proper citation: RRID:Addgene_110500 Copy   


  • RRID:Addgene_110505

http://www.addgene.org/110505

Species: Homo sapiens
Genetic Insert: CCDC32
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_110505 Copy   


  • RRID:Addgene_110504

    This resource has 1+ mentions.

http://www.addgene.org/110504

Species: Homo sapiens
Genetic Insert: Rab5C-S35N
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22674975

Proper citation: RRID:Addgene_110504 Copy   


  • RRID:Addgene_110509

http://www.addgene.org/110509

Species: Homo sapiens
Genetic Insert: PLEKHS1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_110509 Copy   


  • RRID:Addgene_110507

http://www.addgene.org/110507

Species: Homo sapiens
Genetic Insert: IQCF2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_110507 Copy   


  • RRID:Addgene_11059

    This resource has 1+ mentions.

http://www.addgene.org/11059

Species: Homo sapiens
Genetic Insert: Paf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGCCCACCATCCAG 3' and 5' CCGCTCGAGTCAGTCACTGTCACTATCAGCTTCACTG 3'

Proper citation: RRID:Addgene_11059 Copy   


  • RRID:Addgene_11052

http://www.addgene.org/11052

Species: Homo sapiens
Genetic Insert: HRPT2 L64P
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Used plasmid 11048 as a template for mutagenesis using the following primers: 5' G GAT TCC ATT TTA TTT CTA CCT AAT AAC GTG CAC CTT TCT C 3' and 5' G AGA AAG GAG CAC GTT ATT AGG TAG AAA TAA AAT GGA ATC C 3'

Proper citation: RRID:Addgene_11052 Copy   


  • RRID:Addgene_11060

    This resource has 1+ mentions.

http://www.addgene.org/11060

Species: Homo sapiens
Genetic Insert: Rtf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CCCAAGCTTATGAAGAAACAGGCCAACA 3' and 5' CCGCTCGAGAATAAGCCCTCGTCGTTT 3'

Proper citation: RRID:Addgene_11060 Copy   


  • RRID:Addgene_110516

http://www.addgene.org/110516

Species: Homo sapiens
Genetic Insert: PCDHB10
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_110516 Copy   


  • RRID:Addgene_110638

http://www.addgene.org/110638

Species: Homo sapiens
Genetic Insert: SFXN4
Vector Backbone Description: Backbone Marker:Cell Biolabs, Inc.; Backbone Size:5600; Vector Backbone:pMXs-IRES-Blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30442778

Proper citation: RRID:Addgene_110638 Copy   


  • RRID:Addgene_110636

http://www.addgene.org/110636

Species: Homo sapiens
Genetic Insert: SFXN2
Vector Backbone Description: Backbone Marker:Cell Biolabs, Inc.; Backbone Size:5600; Vector Backbone:pMXs-IRES-Blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30442778

Proper citation: RRID:Addgene_110636 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X