Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5855; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, golden gate entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26853913
Proper citation: RRID:Addgene_72656 Copy
Species: Danio rerio
Genetic Insert: elavl3 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR 221; Vector Types:; Bacterial Resistance:Kanamycin
Comments: Fujimoto E, Gaynes B, Brimley CJ, Chien CB, Bonkowsky JL. Gal80 intersectional regulation of cell-type specific expression in vertebrates. Dev Dyn. 2011 Oct;240(10):2324-34. doi: 10.1002/dvdy.22734. Epub 2011 Sep 8. PubMed PMID:21905164; PubMed Central PMCID: PMC3178006.
Proper citation: RRID:Addgene_72640 Copy
Genetic Insert: LexATF-T2A-NLS-LexA-mCherry-LEXY
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26853913
Proper citation: RRID:Addgene_72661 Copy
Species: Rattus norvegicus
Genetic Insert: TrkB
Vector Backbone Description: Vector Backbone:pRFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26630005
Proper citation: RRID:Addgene_72714 Copy
Species: E. coli DH5A
Genetic Insert: PatoG
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:OG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Capillary sequence files used the primers CATCTTCGATGGATAGCGATT and TGTACGGGATCTCCTTCTCG to verify MCS region including the promoter and the start codon of daGFP.
Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72839 Copy
Species: E. coli DH5A
Genetic Insert: PatoM
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:OG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Capillary sequence files used the primers CATCTTCGATGGATAGCGATT and TGTACGGGATCTCCTTCTCG to verify MCS region including the promoter and the start codon of daGFP. Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72842 Copy
Species: E. coli DH5A
Genetic Insert: PatoK
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:OG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Capillary sequence files used the primers CATCTTCGATGGATAGCGATT and TGTACGGGATCTCCTTCTCG to verify MCS region including the promoter and the start codon of daGFP.
Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72840 Copy
Species: E. coli DH5A
Genetic Insert: PatoM
Vector Backbone Description: Vector Backbone:LOG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72847 Copy
Species: E. coli DH5A
Genetic Insert: PatoK
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:LOG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72848 Copy
Species: Homo sapiens
Genetic Insert: Target of rapamycin complex 2 subunit MAPKAP1, isoform 2
Vector Backbone Description: Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28143890
Proper citation: RRID:Addgene_72908 Copy
Species: Homo sapiens
Genetic Insert: mSin1.1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28143890
Comments: mSin1.1 was amplified from HEK293 cDNA library
Proper citation: RRID:Addgene_72907 Copy
Species: Homo sapiens
Genetic Insert: hBACCS2-IRES-mCherry
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Proper citation: RRID:Addgene_72892 Copy
Species: Homo sapiens
Genetic Insert: hBACCS2-IRES-GFP
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Proper citation: RRID:Addgene_72891 Copy
Species: Drosophila melanogaster
Genetic Insert: dmBACCS2VL-IRES-dOrai-IRES-GFP
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Comments: dmBACCS2VL is a slow recovery kinetic mutant of dmBACCS2.
Proper citation: RRID:Addgene_72897 Copy
Species: Drosophila melanogaster
Genetic Insert: dmBACCS2-IRES-dOrai-IRES-mCherry
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Proper citation: RRID:Addgene_72894 Copy
Species: Drosophila melanogaster
Genetic Insert: dmBACCS2NS-IRES-dOrai-IRES-GFP
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Comments: dmBACCS2NS is a fast recovery kinetic mutant of dmBACCS2.
Proper citation: RRID:Addgene_72895 Copy
Species: Homo sapiens
Genetic Insert: Galectin-3
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23921551
Comments: This plasmid is used to detect ruptured lysosomal membrane by lysosomotropic agents or endosomal membrane accompanied with invading bacteria.
Proper citation: RRID:Addgene_73080 Copy
Species: Bacillus cereus ATCC 14579
Genetic Insert: pET24a
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET24; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21531795
Comments: Cells were harvested via centrifugation, resus-pended in 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 0.1 mMdithiothreitol(DTT) (TED), and frozen at -80°C. Following thawing, cells were lysed bymicrofluidization and cell debris was removed by centrifugation. The lysate wasfractionated by first bringing the solution to 30% saturation, discarding thepellet, and then subsequently increasing the saturation to 60% and 90% with(NH4)2SO4and dissolving the precipitates in TED. The protein was further
purified using hydrophobic interaction chromatography over a HiPrep 16/10phenyl FF (high sub) column (GE Healthcare), dialyzed against TED, andsubjected to anion exchange chromatography over a Source Q column (GEHealthcare). The eluted protein was passed over a HiPrep 26/60 Sephacryl S100HR column (GE Healthcare) for size exclusion.
The structure was determined by X-ray Crystallography and deposited in the PDB as 3Q1P 3Q4I
Proper citation: RRID:Addgene_73161 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols
Proper citation: RRID:Addgene_73169 Copy
Species: Homo sapiens
Genetic Insert: SNORD116-13
Vector Backbone Description: Backbone Marker:Zefeng Wang's lab; Backbone Size:4700; Vector Backbone:pZW1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25378317
Comments: Two snoRNA genes SNORD116-13 and SNORD116-14 from the Prader–Willi syndrome deletion region flanked by multiple cloning sites were inserted into the weak intron of Enhanced Green Fluoresence Protein (EGFP) such that only proper splicing leads to EGFP fluorescence.
Proper citation: RRID:Addgene_73174 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
