Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Gallus gallus
Genetic Insert: cOVA
Vector Backbone Description: Backbone Size:8533; Vector Backbone:pLVX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_135073 Copy
Vector Backbone Description: Backbone Size:8668; Vector Backbone:pJOE7706.1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24863652
Comments: Please note: Plasmid contains a S30Y mutation in EGFP. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_135075 Copy
Species: E.coli
Genetic Insert: rhaR rhaS rhaPBAD eGFP, mob
Vector Backbone Description: Vector Backbone:pJOE4776.1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19789867
Proper citation: RRID:Addgene_135088 Copy
Species: Homo sapiens
Genetic Insert: NEMO
Vector Backbone Description: Backbone Marker:Made in Guan Lab; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for more information.
Proper citation: RRID:Addgene_13512 Copy
Vector Backbone Description: Backbone Size:5288; Vector Backbone:pOO2-GW; Vector Types:bacterial expression vector for generating SP6 transcripts in vitro for Xenopus oocyte transfection; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21107422
Comments: The AtAMT1;1 coding sequence with the att sites (attB1 and attB2) from the pDRf1-AtAMT1;1 (Loque et al 2007 Nature 446 195-198) was remobilized with both restriction enzymes SpeI and XhoI then subsequently cloned between SpeI and XhoI sites in the p6013-002 (Ludewig et al., 2002 J. Biol. Chem. 277, 13548-13555). The AtAMT1;1 coding sequence was then replaced by the Gateway DNA cassette after a BP reaction with pDONR 221 (GATEWAY technology, Invitrogen) to generate the p002-GW vector.
Proper citation: RRID:Addgene_135097 Copy
Species: Homo sapiens
Genetic Insert: FKHR H215R AAA
Vector Backbone Description: Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for map of wild-type pcDNA3-flag-FKHR.
Proper citation: RRID:Addgene_13510 Copy
Species: Homo sapiens
Genetic Insert: 3xIRS
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5800; Vector Backbone:pGL2-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS.
See "Author's Map" for more information.
Proper citation: RRID:Addgene_13511 Copy
Species: Homo sapiens
Genetic Insert: MKK6(glu)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8622669
Proper citation: RRID:Addgene_13518 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8622669
Proper citation: RRID:Addgene_13517 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Green lab; Backbone Size:3301; Vector Backbone:Z1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:42490567
Proper citation: RRID:Addgene_135046 Copy
Species: Homo sapiens
Genetic Insert: FKHR H215R
Vector Backbone Description: Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for map of wild-type pcDNA3-flag-FKHR.
Proper citation: RRID:Addgene_13509 Copy
Species: Homo sapiens
Genetic Insert: SMURF2
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11163210
Proper citation: RRID:Addgene_13505 Copy
Species: Synthetic
Genetic Insert: sfGFP_RED20
Vector Backbone Description: Backbone Size:2000; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31511890
Proper citation: RRID:Addgene_135173 Copy
Species: Mus musculus
Genetic Insert: TPC2
Vector Backbone Description: Backbone Size:8080; Vector Backbone:pLVXpuro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25872774
Comments: IMAGE clone: 9055807
ImaGenes collection: IRCKp5014F1215Q
GeneBank: BC141195
Proper citation: RRID:Addgene_135183 Copy
Species: Synthetic
Genetic Insert: CmR
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29065183
Comments: Contains two multiple cloning sites for insertion of homologous regions for targeted deletion via lamba red system in E. coli.
Contains I-CreI flanking the Cm cassette outside of the flanking multiple cloning sites for excision of homologous regions and CmR marker from the plasmid.
Contains I-SceI sites flanking the Cm cassette to allow for excision of the Cm cassette after integration into the E. coli genome for markerless deletion.
Proper citation: RRID:Addgene_135188 Copy
Species: Homo sapiens
Genetic Insert: MKK6(K82A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8622669
Comments: Please note there are 3 additional mutations found in the QC sequence that are not present in the NGS full sequencing result. These mutations have no affect on the plasmid function.
Proper citation: RRID:Addgene_13519 Copy
Genetic Insert: msGFP2
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pQE-60NA; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32415747
Proper citation: RRID:Addgene_135301 Copy
Species: Homo sapiens
Genetic Insert: MYC
Vector Backbone Description: Backbone Size:6574; Vector Backbone:MSCV_IRES_huDC2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31586074
Proper citation: RRID:Addgene_135306 Copy
Species: Homo sapiens
Genetic Insert: Flag-CDK13
Vector Backbone Description: Backbone Size:9763; Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral, Gateway Destination; Bacterial Resistance:Ampicillin
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. These lentiviral gateway destination plasmids were generated, as part of the Kinase-Data and Resource Generating Center (DRGC), using the single fragment or multisite gateway cloning technology. They were used for generating proteomics-based protein-interaction and protein-proximity networks that can be accessed through the kinase-DRGC website https://darkkinome.org/. Each plasmid has either an N- or C-terminal fusion protein (Flag/ V5/V5-miniTurbo/V5-TurboID/miniTurbo-V5/TurboID-V5) tagged understudied kinase driven under either a CMV or Ubiquitin (UBC) promoter. All inserts in the pENTR plasmids used to generate the deposited destination plasmids were end-sequenced and insert size validated prior to multi-site gateway cloning. The combined insert size of the single fragment or three fragment destination plasmids were confirmed by restriction digestion (BsrGI, and EcoRV for pDest667; BsrGI, EcoRV, and BstZ17I for pDest663; and BsrGI for pHAGE) and all plasmids were partially sequenced to ensure in-frame ORFs and fusion tags.
Proper citation: RRID:Addgene_135276 Copy
Species: Synthetic
Genetic Insert: ChrimsonR
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4827; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35060903
Comments: Please visit https://www.biorxiv.org/content/10.1101/2019.12.13.876128v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_135319 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
