Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLVX-puro-cOVA Resource Report Resource Website 1+ mentions |
RRID:Addgene_135073 | cOVA | Gallus gallus | Ampicillin | Backbone Size:8533; Vector Backbone:pLVX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:45 | 2 | |||
|
pJOE7706.1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_135075 | Kanamycin | PMID:24863652 | Please note: Plasmid contains a S30Y mutation in EGFP. This mutation is not known to affect plasmid function. | Backbone Size:8668; Vector Backbone:pJOE7706.1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 12:55:45 | 1 | |||
|
pJeM1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_135088 | rhaR rhaS rhaPBAD eGFP, mob | E.coli | Kanamycin | PMID:19789867 | Vector Backbone:pJOE4776.1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 12:55:46 | 2 | ||
|
pcDNA3 HA human NEMO Resource Report Resource Website 10+ mentions |
RRID:Addgene_13512 | NEMO | Homo sapiens | Ampicillin | PMID:10358014 | See "Author's Map" for more information. | Backbone Marker:Made in Guan Lab; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:47 | 10 | |
|
pOO2-GW Resource Report Resource Website 1+ mentions |
RRID:Addgene_135097 | Chloramphenicol and Ampicillin | PMID:21107422 | The AtAMT1;1 coding sequence with the att sites (attB1 and attB2) from the pDRf1-AtAMT1;1 (Loque et al 2007 Nature 446 195-198) was remobilized with both restriction enzymes SpeI and XhoI then subsequently cloned between SpeI and XhoI sites in the p6013-002 (Ludewig et al., 2002 J. Biol. Chem. 277, 13548-13555). The AtAMT1;1 coding sequence was then replaced by the Gateway DNA cassette after a BP reaction with pDONR 221 (GATEWAY technology, Invitrogen) to generate the p002-GW vector. | Backbone Size:5288; Vector Backbone:pOO2-GW; Vector Types:bacterial expression vector for generating SP6 transcripts in vitro for Xenopus oocyte transfection; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 12:55:45 | 1 | |||
|
pcDNA3 Flag FKHR H215R AAA mutant Resource Report Resource Website 1+ mentions |
RRID:Addgene_13510 | FKHR H215R AAA | Homo sapiens | Ampicillin | PMID:10358014 | See "Author's Map" for map of wild-type pcDNA3-flag-FKHR. | Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | H215R T24A S256A S319A | 2026-08-29 12:55:46 | 1 |
|
3xIRS luciferase Resource Report Resource Website 1+ mentions |
RRID:Addgene_13511 | 3xIRS | Homo sapiens | Ampicillin | PMID:10358014 | Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS. See "Author's Map" for more information. | Backbone Marker:Promega; Backbone Size:5800; Vector Backbone:pGL2-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:46 | 4 | |
|
pCDNA3-Flag MKK6(glu) Resource Report Resource Website 10+ mentions |
RRID:Addgene_13518 | MKK6(glu) | Homo sapiens | Ampicillin | PMID:8622669 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ser-207Glu Thr-211Glu | 2026-08-29 12:55:46 | 33 | |
|
pCDNA3-Flag MKK6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_13517 | MKK6 | Homo sapiens | Ampicillin | PMID:8622669 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:47 | 7 | ||
|
CAG-eGFP-Z1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_135046 | eGFP | Synthetic | Bleocin (Zeocin) | PMID:42490567 | Backbone Marker:Green lab; Backbone Size:3301; Vector Backbone:Z1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 12:55:46 | 2 | ||
|
pcDNA3 Flag FKHR H215R Resource Report Resource Website 1+ mentions |
RRID:Addgene_13509 | FKHR H215R | Homo sapiens | Ampicillin | PMID:10358014 | See "Author's Map" for map of wild-type pcDNA3-flag-FKHR. | Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | H215R | 2026-08-29 12:55:45 | 1 |
|
pGEX4T1-Smurf2 C716A Resource Report Resource Website 1+ mentions |
RRID:Addgene_13505 | SMURF2 | Homo sapiens | Ampicillin | PMID:11163210 | Backbone Size:4900; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | C716A: catalytically inactive | 2026-08-29 12:55:45 | 1 | |
|
pSB1C3-pT7-sfGFP_RED20 Resource Report Resource Website 1+ mentions |
RRID:Addgene_135173 | sfGFP_RED20 | Synthetic | Chloramphenicol | PMID:31511890 | Backbone Size:2000; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Recoded ORF of sfGFP to only use one codon per amino acid | 2026-08-29 12:55:46 | 1 | |
|
TPC2-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_135183 | TPC2 | Mus musculus | Ampicillin | PMID:25872774 | IMAGE clone: 9055807 ImaGenes collection: IRCKp5014F1215Q GeneBank: BC141195 | Backbone Size:8080; Vector Backbone:pLVXpuro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:46 | 1 | |
|
pBDC Resource Report Resource Website 1+ mentions |
RRID:Addgene_135188 | CmR | Synthetic | Chloramphenicol | PMID:29065183 | Contains two multiple cloning sites for insertion of homologous regions for targeted deletion via lamba red system in E. coli. Contains I-CreI flanking the Cm cassette outside of the flanking multiple cloning sites for excision of homologous regions and CmR marker from the plasmid. Contains I-SceI sites flanking the Cm cassette to allow for excision of the Cm cassette after integration into the E. coli genome for markerless deletion. | Vector Backbone:N/A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol | None | 2026-08-29 12:55:47 | 1 |
|
pCDNA3-Flag MKK6(K82A) Resource Report Resource Website 10+ mentions |
RRID:Addgene_13519 | MKK6(K82A) | Homo sapiens | Ampicillin | PMID:8622669 | Please note there are 3 additional mutations found in the QC sequence that are not present in the NGS full sequencing result. These mutations have no affect on the plasmid function. | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Lys-82Ala | 2026-08-29 12:55:46 | 12 |
|
pQE-60NA-msGFP2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_135301 | msGFP2 | Ampicillin | PMID:32415747 | Backbone Size:3402; Vector Backbone:pQE-60NA; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:47 | 2 | |||
|
MSCV-MYC-t2A-BCL2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_135306 | MYC | Homo sapiens | Ampicillin | PMID:31586074 | Backbone Size:6574; Vector Backbone:MSCV_IRES_huDC2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:49 | 1 | ||
|
pHAGE-CMV-Flag-CDK13_IDG-K Resource Report Resource Website 1+ mentions |
RRID:Addgene_135276 | Flag-CDK13 | Homo sapiens | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. These lentiviral gateway destination plasmids were generated, as part of the Kinase-Data and Resource Generating Center (DRGC), using the single fragment or multisite gateway cloning technology. They were used for generating proteomics-based protein-interaction and protein-proximity networks that can be accessed through the kinase-DRGC website https://darkkinome.org/. Each plasmid has either an N- or C-terminal fusion protein (Flag/ V5/V5-miniTurbo/V5-TurboID/miniTurbo-V5/TurboID-V5) tagged understudied kinase driven under either a CMV or Ubiquitin (UBC) promoter. All inserts in the pENTR plasmids used to generate the deposited destination plasmids were end-sequenced and insert size validated prior to multi-site gateway cloning. The combined insert size of the single fragment or three fragment destination plasmids were confirmed by restriction digestion (BsrGI, and EcoRV for pDest667; BsrGI, EcoRV, and BstZ17I for pDest663; and BsrGI for pHAGE) and all plasmids were partially sequenced to ensure in-frame ORFs and fusion tags. | Backbone Size:9763; Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral, Gateway Destination; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:47 | 1 | ||
|
flex-ChrimsonR-EYFP-Kv Resource Report Resource Website 1+ mentions |
RRID:Addgene_135319 | ChrimsonR | Synthetic | Ampicillin | PMID:35060903 | Please visit https://www.biorxiv.org/content/10.1101/2019.12.13.876128v1 for bioRxiv preprint. | Backbone Marker:Stratagene; Backbone Size:4827; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:49 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
