Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 429 showing 8561 ~ 8580 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_178361

    This resource has 1+ mentions.

http://www.addgene.org/178361

Species: Synthetic
Genetic Insert: jGCaMP7b-XC
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36196992
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.09.475579v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178361 Copy   


  • RRID:Addgene_17827

    This resource has 1+ mentions.

http://www.addgene.org/17827

Species: Discosoma sp., A. victoria
Genetic Insert: E. coli optimized red flourescent protein (RFPec), GFPuv
Vector Backbone Description: Backbone Marker:Groningen Biotechnology Center; Backbone Size:0; Vector Backbone:pBAD24; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16845378

Proper citation: RRID:Addgene_17827 Copy   


  • RRID:Addgene_178330

    This resource has 1+ mentions.

http://www.addgene.org/178330

Species: Mus musculus
Genetic Insert: pAAV hSyn iGluSnFR3 v857.SGZ
Vector Backbone Description: Backbone Size:4200; Vector Backbone:pAAV hSyn; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767

Proper citation: RRID:Addgene_178330 Copy   


  • RRID:Addgene_17840

    This resource has 1+ mentions.

http://www.addgene.org/17840

Species: Homo sapiens
Genetic Insert: T210A-ATX
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5200; Vector Backbone:pSecTag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18327261

Proper citation: RRID:Addgene_17840 Copy   


  • RRID:Addgene_17843

    This resource has 10+ mentions.

http://www.addgene.org/17843

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12535517
Comments: This clone was generated by my postdoctoral felllow: Xavier Espanel.

Proper citation: RRID:Addgene_17843 Copy   


  • RRID:Addgene_17844

    This resource has 1+ mentions.

http://www.addgene.org/17844

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12535517
Comments: This clone was generated by my postdoctoral felllow: Akihiko Komuro.

Proper citation: RRID:Addgene_17844 Copy   


  • RRID:Addgene_178430

    This resource has 1+ mentions.

http://www.addgene.org/178430

Species: Quail
Genetic Insert: TVA950 Glu66→Thr
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV, Cre/Lox, Adeno-associated virus; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_178430 Copy   


  • RRID:Addgene_178459

    This resource has 1+ mentions.

http://www.addgene.org/178459

Species: Homo sapiens
Genetic Insert: GGA1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12686608
Comments: Please note: Plasmid contains a S434L mutation in GGA1 compared to the NCBI reference sequence NP_037497.1. This mutation is not known to affect plasmid function.

Proper citation: RRID:Addgene_178459 Copy   


  • RRID:Addgene_178451

    This resource has 1+ mentions.

http://www.addgene.org/178451

Species: Homo sapiens
Genetic Insert: BATF
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35245086

Proper citation: RRID:Addgene_178451 Copy   


  • RRID:Addgene_178449

    This resource has 1+ mentions.

http://www.addgene.org/178449

Species: Homo sapiens
Genetic Insert: STAT2
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35245086

Proper citation: RRID:Addgene_178449 Copy   


  • RRID:Addgene_17854

    This resource has 1+ mentions.

http://www.addgene.org/17854

Species: Homo sapiens
Genetic Insert: shSHP2
Vector Backbone Description: Backbone Marker:Chen lab; Backbone Size:8200; Vector Backbone:MDH1-404-H2Kb2; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17382377
Comments: Target region of SHP-2: TTGCCCACGCATATCATGTAGT (NM_011202.3: 5421 to 5442, 3’ UTR).

Proper citation: RRID:Addgene_17854 Copy   


  • RRID:Addgene_178589

    This resource has 1+ mentions.

http://www.addgene.org/178589

Species: Other
Genetic Insert: miRE-Ptbp1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34582787

Proper citation: RRID:Addgene_178589 Copy   


http://www.addgene.org/17867

Species: E. coli
Genetic Insert: FLII12Pglu-700uDelta6
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF/myc/ER; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18177733

Proper citation: RRID:Addgene_17867 Copy   


  • RRID:Addgene_178583

    This resource has 1+ mentions.

http://www.addgene.org/178583

Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34582787

Proper citation: RRID:Addgene_178583 Copy   


  • RRID:Addgene_17868

    This resource has 1+ mentions.

http://www.addgene.org/17868

Species: Mus musculus
Genetic Insert: NFATc3
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11439183
Comments: Full-length mNFATc3

Proper citation: RRID:Addgene_17868 Copy   


http://www.addgene.org/178582

Species: Homo sapiens
Genetic Insert: NEUROD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34582787

Proper citation: RRID:Addgene_178582 Copy   


  • RRID:Addgene_178523

    This resource has 1+ mentions.

http://www.addgene.org/178523

Species: Mus musculus
Genetic Insert: Stargazin-mEGFP-iLID
Vector Backbone Description: Backbone Size:4720; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34880255
Comments: The sequence and plasmid map is available in the following benchling link (https://benchling.com/s/seq-XUhPNN7CavWnbGAq1TUe).

Proper citation: RRID:Addgene_178523 Copy   


  • RRID:Addgene_17871

    This resource has 1+ mentions.

http://www.addgene.org/17871

Species: Mus musculus
Genetic Insert: CnA alpha
Vector Backbone Description: Backbone Size:3300; Vector Backbone:pBJ5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1377362

Proper citation: RRID:Addgene_17871 Copy   


  • RRID:Addgene_178734

    This resource has 1+ mentions.

http://www.addgene.org/178734

Species: Bos taurus
Genetic Insert: GRK2
Vector Backbone Description: Backbone Size:9173; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35045279

Proper citation: RRID:Addgene_178734 Copy   


  • RRID:Addgene_17873

    This resource has 1+ mentions.

http://www.addgene.org/17873

Species: Homo sapiens
Genetic Insert: Brg
Vector Backbone Description: Backbone Size:3300; Vector Backbone:pBJ5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8232556
Comments: This plasmid is an expression vector for the full length BRG/BAF190 protein which is similar to Drosphila Brm and contains the conserved ATPase domain in the yeast SWI2/SNF2 protein. Addgene QC NGS analysis identifies an R1608Q mutation relative to NP_001122316.1.

Proper citation: RRID:Addgene_17873 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X