Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDEST-CMV-C-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_122844 | Chloramphenicol and Ampicillin | PMID:30661429 | Backbone Size:7059; Vector Backbone:pDEST-CMV-polysite; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:47 | 4 | ||||
|
pDEST-CMV-N-Tandem-mCherry-EGFP Resource Report Resource Website |
RRID:Addgene_123216 | Chloramphenicol and Ampicillin | PMID:30661429 | Backbone Marker:Life Technologies; Backbone Size:7720; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:52 | 0 | ||||
|
pDEST-CMV-N-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_123215 | Chloramphenicol and Ampicillin | PMID:30661429 | Backbone Marker:Life Technologies; Backbone Size:7720; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:52 | 5 | ||||
|
pPWCh Resource Report Resource Website |
RRID:Addgene_124238 | Chloramphenicol and Ampicillin | PMID:27006187 | Backbone Size:12314; Vector Backbone:pPW; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:04:04 | 0 | ||||
|
pAGW-dpse-GAL4-DBD Resource Report Resource Website 1+ mentions |
RRID:Addgene_125153 | D. pseudoobscura peak #102 enhancer and D. pseudoobscura CG13116 CP | Other | Chloramphenicol and Ampicillin | PMID:31092928 | Backbone Marker:Promega; Backbone Size:2962; Vector Backbone:Unknown; Vector Types:Insect Expression, Gateway fly expression vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:04:13 | 1 | ||
|
pSTAP-seq_human-4xUAS Resource Report Resource Website 1+ mentions |
RRID:Addgene_125150 | 4 x upstream activating sequence (UAS) | Saccharomyces cerevisiae | Chloramphenicol and Ampicillin | PMID:31092928 | Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:04:13 | 1 | ||
|
pSTAP-seq_fly_spike-in Resource Report Resource Website |
RRID:Addgene_125151 | D. pseudoobscura peak #47 enhancer | Other | Chloramphenicol and Ampicillin | PMID:31092928 | Backbone Marker:Promega; Backbone Size:3078; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:04:13 | 0 | ||
|
pDEST-N2H-C1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_125549 | Chloramphenicol and Ampicillin | PMID:31467278 | Addgene NGS results identified an IS4-like element located between the Chloramphenicol resistance and ccdB genes. This element will not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/530790v1.full for bioRxiv preprint. | Backbone Marker:we built; Backbone Size:10101; Vector Backbone:custom made; Vector Types:Mammalian Expression, Yeast Expression, in vitro expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:04:16 | 2 | |||
|
pTEI161 Resource Report Resource Website |
RRID:Addgene_126211 | ccdB Cassette (BsaI) | E.coli | Chloramphenicol and Ampicillin | PMID:31085714 | Vector Backbone:pICH47751; Vector Types:Plant Expression, Binary, Module 1; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:04:23 | 0 | ||
|
pcDNA3-FLAG- gate-pGK-HYG Resource Report Resource Website 1+ mentions |
RRID:Addgene_107397 | Chloramphenicol and Ampicillin | PMID:24292623 | Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:01:10 | 1 | ||||
|
MAC-tag-C Resource Report Resource Website 10+ mentions |
RRID:Addgene_108077 | CCDB | Other | Chloramphenicol and Ampicillin | PMID:29568061 | Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:01:16 | 10 | ||
|
MAC-tag-N Resource Report Resource Website 1+ mentions |
RRID:Addgene_108078 | CCDB | Other | Chloramphenicol and Ampicillin | PMID:29568061 | Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:01:16 | 9 | ||
|
SITS-ccdb-EGFP Resource Report Resource Website |
RRID:Addgene_118752 | ccdb | Chloramphenicol and Ampicillin | PMID:32709891 | Vector Backbone:I-SceI; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:07 | 0 | |||
|
pGEX6P1-DEST-Myc Resource Report Resource Website |
RRID:Addgene_119752 | Chloramphenicol and Ampicillin | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-6-P1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:15 | 0 | |||||
|
pMSCVpuro-DEST Resource Report Resource Website 1+ mentions |
RRID:Addgene_119745 | Chloramphenicol and Ampicillin | PMID:29959219 | Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:15 | 2 | ||||
|
pLenti-sgRNA(lib)-puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_119976 | Chloramphenicol and Ampicillin | PMID:30395134 | Backbone Marker:Wensheng Wei Lab; Backbone Size:9882; Vector Backbone:pLenti-sgRNA-lib 2.0 (Addgene plasmid #89638); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:17 | 1 | ||||
|
PB-TAC-KRAB-dCas9 Resource Report Resource Website |
RRID:Addgene_120355 | Chloramphenicol and Ampicillin | PMID:30639212 | Vector Backbone:pBluescript; Vector Types:Mammalian Expression, CRISPR, piggyBac transposon; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:21 | 0 | ||||
|
pBSDONR P4r-P2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_121527 | Chloramphenicol and Ampicillin | PMID:21343429 | Contains Gateway Entry Cassette with ccdB gene and chloramphenicol resistance. To make this vector, sequences from the GateWay cassettes of pDONR221 P4r-P3r and pDONR221 P3-P2 were subcloned into pBlueScript. The purpose of this was to create a DONR vector with ampicillin resistance rather than kanamycin resistance, which facilitates use of kanamycin resistant destination vectors. The combination of P4r-P2 att sites enables multisite Gateway cloning in which the N-terminal sequence is cloned into a P1-P4 donor vector and the C-terminal sequence is cloned into this vector, with the destination vector containing P1-P2 att sites. | Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:03:37 | 2 | |||
|
pTW065 Resource Report Resource Website |
RRID:Addgene_115952 | Lvl0 3'UTR Dest | Synthetic | Chloramphenicol and Ampicillin | PMID:30327560 | Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:02:39 | 0 | ||
|
pPRIME-CMV-GFP-FF3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11663 | FF3 | Firefly | Chloramphenicol and Ampicillin | PMID:16141338 | CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted. | Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:02:46 | 5 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
