Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:7059; Vector Backbone:pDEST-CMV-polysite; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429
Proper citation: RRID:Addgene_122844 Copy
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:7720; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429
Proper citation: RRID:Addgene_123216 Copy
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:7720; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429
Proper citation: RRID:Addgene_123215 Copy
Vector Backbone Description: Backbone Size:12314; Vector Backbone:pPW; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27006187
Proper citation: RRID:Addgene_124238 Copy
Species: Other
Genetic Insert: D. pseudoobscura peak #102 enhancer and D. pseudoobscura CG13116 CP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2962; Vector Backbone:Unknown; Vector Types:Insect Expression, Gateway fly expression vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928
Proper citation: RRID:Addgene_125153 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 4 x upstream activating sequence (UAS)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928
Proper citation: RRID:Addgene_125150 Copy
Species: Other
Genetic Insert: D. pseudoobscura peak #47 enhancer
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3078; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928
Proper citation: RRID:Addgene_125151 Copy
Vector Backbone Description: Backbone Marker:we built; Backbone Size:10101; Vector Backbone:custom made; Vector Types:Mammalian Expression, Yeast Expression, in vitro expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31467278
Comments: Addgene NGS results identified an IS4-like element located between the Chloramphenicol resistance and ccdB genes. This element will not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/530790v1.full for bioRxiv preprint.
Proper citation: RRID:Addgene_125549 Copy
Species: E.coli
Genetic Insert: ccdB Cassette (BsaI)
Vector Backbone Description: Vector Backbone:pICH47751; Vector Types:Plant Expression, Binary, Module 1; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31085714
Proper citation: RRID:Addgene_126211 Copy
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24292623
Proper citation: RRID:Addgene_107397 Copy
Species: Other
Genetic Insert: CCDB
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:29568061
Proper citation: RRID:Addgene_108077 Copy
Species: Other
Genetic Insert: CCDB
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:29568061
Proper citation: RRID:Addgene_108078 Copy
Genetic Insert: ccdb
Vector Backbone Description: Vector Backbone:I-SceI; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32709891
Proper citation: RRID:Addgene_118752 Copy
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-6-P1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_119752 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:29959219
Proper citation: RRID:Addgene_119745 Copy
Vector Backbone Description: Backbone Marker:Wensheng Wei Lab; Backbone Size:9882; Vector Backbone:pLenti-sgRNA-lib 2.0 (Addgene plasmid #89638); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30395134
Proper citation: RRID:Addgene_119976 Copy
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Mammalian Expression, CRISPR, piggyBac transposon; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30639212
Proper citation: RRID:Addgene_120355 Copy
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21343429
Comments: Contains Gateway Entry Cassette with ccdB gene and chloramphenicol resistance. To make this vector, sequences from the GateWay cassettes of pDONR221 P4r-P3r and pDONR221 P3-P2 were subcloned into pBlueScript. The purpose of this was to create a DONR vector with ampicillin resistance rather than kanamycin resistance, which facilitates use of kanamycin resistant destination vectors. The combination of P4r-P2 att sites enables multisite Gateway cloning in which the N-terminal sequence is cloned into a P1-P4 donor vector and the C-terminal sequence is cloned into this vector, with the destination vector containing P1-P2 att sites.
Proper citation: RRID:Addgene_121527 Copy
Species: Synthetic
Genetic Insert: Lvl0 3'UTR Dest
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30327560
Proper citation: RRID:Addgene_115952 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC).
Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.
Proper citation: RRID:Addgene_11663 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
