Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Small Ubiquitin Like Modifier 1
Vector Backbone Description: Backbone Size:7713; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25805818
Proper citation: RRID:Addgene_164939 Copy
Species: Homo sapiens
Genetic Insert: Small Ubiquitin Like Modifier 2
Vector Backbone Description: Backbone Size:6325; Vector Backbone:MSCVpuro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25805818
Proper citation: RRID:Addgene_164938 Copy
Species: Synthetic
Genetic Insert: Enhanced green fluorescent protein
Vector Backbone Description: Backbone Size:12176; Vector Backbone:pInducer-10b; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25093678
Proper citation: RRID:Addgene_164935 Copy
Species: Homo sapiens
Genetic Insert: human UBC9
Vector Backbone Description: Backbone Size:6974; Vector Backbone:pMSCVhyg; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25805818
Proper citation: RRID:Addgene_164936 Copy
Species: Caenorhabditis elegans
Genetic Insert: rpl28-rtTA(Q)
Vector Backbone Description: Vector Backbone:puc57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30634168
Proper citation: RRID:Addgene_164886 Copy
Species: Caenorhabditis elegans
Genetic Insert: rtetR-zip
Vector Backbone Description: Vector Backbone:puc57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30634168
Proper citation: RRID:Addgene_164889 Copy
Species: Synthetic
Genetic Insert: Enhanced green fluorescent protein
Vector Backbone Description: Backbone Size:7140; Vector Backbone:MSCVpic2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27891214
Proper citation: RRID:Addgene_164922 Copy
Species: Synthetic
Genetic Insert: Enhanced green fluorescent protein
Vector Backbone Description: Backbone Size:6735; Vector Backbone:MSCVpic2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27891214
Proper citation: RRID:Addgene_164923 Copy
Species: Caenorhabditis elegans
Genetic Insert: QFAD mutated
Vector Backbone Description: Vector Backbone:puc57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30634168
Proper citation: RRID:Addgene_164887 Copy
Species: Homo sapiens
Genetic Insert: KRAS proto-oncogene, GTPase (KRAS)
Vector Backbone Description: Backbone Size:12168; Vector Backbone:pInducer-10b; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25100204
Proper citation: RRID:Addgene_164926 Copy
Species: Synthetic
Genetic Insert: Enhanced green fluorescent protein
Vector Backbone Description: Backbone Size:12176; Vector Backbone:pInducer-10b; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25093678
Proper citation: RRID:Addgene_164925 Copy
Species: Danio rerio
Genetic Insert: kcnma1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33728688
Comments: The DNA sequence was amplified from pooled wild type TAB zebrafish embryos. There is a likely polymorphism, N416D, which is not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. But this will not impact the result of whole mount in situ hybridization
Proper citation: RRID:Addgene_164951 Copy
Species: Danio rerio
Genetic Insert: kcnj13
Vector Backbone Description: Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32546498
Proper citation: RRID:Addgene_164950 Copy
Species: Danio rerio
Genetic Insert: kcnmb3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33728688
Proper citation: RRID:Addgene_164955 Copy
Species: Danio rerio
Genetic Insert: kcnn1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33728688
Comments: The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization.
Proper citation: RRID:Addgene_164956 Copy
Species: Danio rerio
Genetic Insert: kcnmb2a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR Cloning Vectror; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33728688
Proper citation: RRID:Addgene_164953 Copy
Species: Danio rerio
Genetic Insert: kcnn3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33728688
Proper citation: RRID:Addgene_164959 Copy
Species: Danio rerio
Genetic Insert: kcnn1b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33728688
Proper citation: RRID:Addgene_164957 Copy
Species: Danio rerio
Genetic Insert: kcnn2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33728688
Proper citation: RRID:Addgene_164958 Copy
Species: Danio rerio
Genetic Insert: kcnj13
Vector Backbone Description: Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32546498
Proper citation: RRID:Addgene_164941 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.