Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 436 showing 8701 ~ 8720 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_165069

http://www.addgene.org/165069

Species: Other
Genetic Insert: gal80Arm1-P-TPI1-KanMX4-gal80Arm2
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165069 Copy   


  • RRID:Addgene_16504

http://www.addgene.org/16504

Species: Homo sapiens
Genetic Insert: Pig10
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4500; Vector Backbone:pBK-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305847

Proper citation: RRID:Addgene_16504 Copy   


  • RRID:Addgene_165067

http://www.addgene.org/165067

Species: Other
Genetic Insert: T-RPL3>ERG20>P-GAL1-P-GAL2>Y-FAST>ErB1.2A-AcNES1>T-RPL41B
Vector Backbone Description: Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Comments: Please note Addgene NGS result identified several mutations in LEU2- V73A, A82G, L199V, D304N. Depositor confirms this does not affect plasmid function. On the contrary the depositor has found "significant improvement on the productivities in the strain harbouring this plasmid."

Proper citation: RRID:Addgene_165067 Copy   


  • RRID:Addgene_16503

http://www.addgene.org/16503

Species: Homo sapiens
Genetic Insert: Pig9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305847

Proper citation: RRID:Addgene_16503 Copy   


  • RRID:Addgene_16501

http://www.addgene.org/16501

Genetic Insert: Mad-binding element from Vg
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9660945
Comments: Four copies of the Mad-binding element from Vg (GCTTGGACTGCCGTCGCGATTC) are cloned into pGL3.

Proper citation: RRID:Addgene_16501 Copy   


  • RRID:Addgene_16500

    This resource has 1+ mentions.

http://www.addgene.org/16500

Genetic Insert: Smad binding element
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9660945
Comments: Two copies of the Smad binding site (taaGTCTAGACggcaGTCTAGACgtac) are cloned into pGL3.

Proper citation: RRID:Addgene_16500 Copy   


  • RRID:Addgene_165061

http://www.addgene.org/165061

Species: Other
Genetic Insert: P-URA3>KlURA3>T-AgTEF1- T-PGK1-P-ACS2> SKP1>OsTIR1opt>T-URA3
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165061 Copy   


  • RRID:Addgene_165064

http://www.addgene.org/165064

Species: Other
Genetic Insert: P-URA3>KlURA3>T-AgTEF1-P-TEF1> (BamHI)yEGFP>T-PGK1-T-URA3
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165064 Copy   


  • RRID:Addgene_165062

http://www.addgene.org/165062

Species: Other
Genetic Insert: T-RPL3>ERG20-N127W>P-GAL1-P-GAL10>Y-FAST>T-ALD6-P-GAL2>ClLS>T-RPL41B
Vector Backbone Description: Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068

Proper citation: RRID:Addgene_165062 Copy   


  • RRID:Addgene_165002

http://www.addgene.org/165002

Species: Homo sapiens
Genetic Insert: TRB
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_165002 Copy   


  • RRID:Addgene_165001

http://www.addgene.org/165001

Species: Homo sapiens
Genetic Insert: TRAV
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_165001 Copy   


  • RRID:Addgene_165006

http://www.addgene.org/165006

Species: Homo sapiens
Genetic Insert: TRB
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_165006 Copy   


  • RRID:Addgene_165007

http://www.addgene.org/165007

Species: Homo sapiens
Genetic Insert: TRAV
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_165007 Copy   


  • RRID:Addgene_165004

http://www.addgene.org/165004

Species: Homo sapiens
Genetic Insert: TRB
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_165004 Copy   


  • RRID:Addgene_165005

http://www.addgene.org/165005

Species: Homo sapiens
Genetic Insert: TRAV
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_165005 Copy   


  • RRID:Addgene_165080

http://www.addgene.org/165080

Species: Homo sapiens
Genetic Insert: OCT4
Vector Backbone Description: Vector Backbone:pMaster; Vector Types:Mammalian Expression, Episomal; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34088009

Proper citation: RRID:Addgene_165080 Copy   


  • RRID:Addgene_165081

    This resource has 1+ mentions.

http://www.addgene.org/165081

Species: Homo sapiens
Genetic Insert: OCT4
Vector Backbone Description: Vector Backbone:pMaster; Vector Types:Mammalian Expression, Episomal; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34088009
Comments: Please note that Addgene's NGS found that the bGH poly(A) signal between one of the oris and Lin28 is absent as compared to the annotated sequence provided by the depositor. Please note that this plasmid contains repetitive elements which are prone to recombination. Screen 3-5 small colonies to ensure the full plasmid is selected. For example, the restriction enzyme NheI can be used to check the plasmid size as shown in Addgene's Diagnostic Digest.

Proper citation: RRID:Addgene_165081 Copy   


  • RRID:Addgene_165008

http://www.addgene.org/165008

Species: Homo sapiens
Genetic Insert: TRB
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338

Proper citation: RRID:Addgene_165008 Copy   


http://www.addgene.org/165079

Species: Synthetic
Genetic Insert: rtTA-M2
Vector Backbone Description: Vector Backbone:pPBCAG; Vector Types:Mammalian Expression, PiggyBac transposition; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33798453

Proper citation: RRID:Addgene_165079 Copy   


http://www.addgene.org/165077

Species: Ruminoccocus flavefaciens XPD3002
Genetic Insert: RfxCas13d
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33288960

Proper citation: RRID:Addgene_165077 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X