Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: MECP2
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216597 Copy
Species: Homo sapiens
Genetic Insert: MECP2
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216599 Copy
Species: Homo sapiens
Genetic Insert: HDR template for human SEC61B
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, HDR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38409044
Proper citation: RRID:Addgene_216250 Copy
Species: Homo sapiens
Genetic Insert: Cas9 and sgRANGAP.C1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, Endogenous tagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38409044
Proper citation: RRID:Addgene_216249 Copy
Species: Homo sapiens
Genetic Insert: ADP-ribosylation factor like 16
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216484 Copy
Species: Homo sapiens
Genetic Insert: IL1B
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37993712
Proper citation: RRID:Addgene_214340 Copy
Species: Homo sapiens
Genetic Insert: ADP-ribosylation factor-like 16
Vector Backbone Description: Backbone Size:4638; Vector Backbone:pET3C; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216485 Copy
Species: Homo sapiens
Genetic Insert: HDR template for human RANGAP1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, TALEN, HDR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38409044
Proper citation: RRID:Addgene_216248 Copy
Species: Homo sapiens
Genetic Insert: USP47
Vector Backbone Description: Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36749823
Proper citation: RRID:Addgene_217626 Copy
Species: Homo sapiens
Genetic Insert: OPEN HLA-A*02:01
Vector Backbone Description: Backbone Size:5242; Vector Backbone:pET24a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37310998
Proper citation: RRID:Addgene_215569 Copy
Species: Homo sapiens
Genetic Insert: CEBPa AroLITE
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215602 Copy
Species: Homo sapiens
Genetic Insert: crCD81-1
Vector Backbone Description: Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217344 Copy
Species: Homo sapiens
Genetic Insert: crCD55-4 gRNA: actggtattgcggagccacgagg
Vector Backbone Description: Vector Backbone:pCH49; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217341 Copy
Species: Homo sapiens
Genetic Insert: crCD55-4 gRNA: actggtattgcggagccacgagg
Vector Backbone Description: Vector Backbone:pCH67; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217345 Copy
Species: Homo sapiens
Genetic Insert: MYOD1 AroLITE C
Vector Backbone Description: Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215619 Copy
Species: Homo sapiens
Genetic Insert: MYOD1
Vector Backbone Description: Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215617 Copy
Species: Homo sapiens
Genetic Insert: HOXD4 AroPERFECT shuffled1
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215577 Copy
Species: Homo sapiens
Genetic Insert: NGN2
Vector Backbone Description: Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215610 Copy
Species: Homo sapiens
Genetic Insert: XBP1
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001079539,ENST00000611155,ENST00000344347 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_143653 Copy
Species: Homo sapiens
Genetic Insert: LHX8
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001256114,ENST00000356261 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142695 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
