Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDONR P4-P1R-mKate2 Resource Report Resource Website |
RRID:Addgene_48344 | mKate2 | Synthetic | Kanamycin | PMID:23957834 | Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | It contains a Kozak sequence but no stop codon. | 2026-08-29 01:06:15 | 0 | |
|
pET His6 Sumo TEV co-transformation cloning vector (13K-S) Resource Report Resource Website |
RRID:Addgene_48321 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Sumo fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3885; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:15 | 0 | ||||
|
pET His6 Thioredoxin TEV co-transformation cloning vector (13K-T) Resource Report Resource Website |
RRID:Addgene_48322 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Thioredoxin fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3912; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:15 | 0 | ||||
|
pET His6 StrepII TEV co-transformation cloning vector (13K-HR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48318 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol.It has a TEV cleavable His6-StrepII fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3612; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:15 | 6 | ||||
|
pET StrepII TEV co-transformation cloning vector (13K-R) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48319 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3576; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:15 | 9 | ||||
|
pET His6 MBP TEV co-transformation cloning vector (13K-C) Resource Report Resource Website |
RRID:Addgene_48317 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-MBP fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4731; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:15 | 0 | ||||
|
pC1-HyPer-Red-C199S Resource Report Resource Website 1+ mentions |
RRID:Addgene_48252 | HYPER-RED-C199S | Synthetic | Kanamycin | PMID:25330925 | Backbone Size:3975; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:14 | 3 | ||
|
pET29b-ClbP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48244 | ClbP | Escherichia coli CFT073 | Kanamycin | PMID:23406518 | Backbone Marker:Novagen; Backbone Size:5370; Vector Backbone:pET29b-(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:14 | 2 | ||
|
pET29b-ClbPpep-CHis Resource Report Resource Website |
RRID:Addgene_48243 | ClbP-pep | Escherichia coli CFT073 | Kanamycin | PMID:23406518 | Backbone Marker:Novagen; Backbone Size:5370; Vector Backbone:pET29b-(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | First 375 amino acids of the peptidase, which contains the soluble periplasmic peptidase domain | 2026-08-29 01:06:14 | 0 | |
|
pDONR P2R-P3-ECFP Resource Report Resource Website |
RRID:Addgene_48353 | ECFP | Synthetic | Kanamycin | PMID:23957834 | Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2651; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Contains a stop codon. | 2026-08-29 01:06:15 | 0 | |
|
3' EGFP pXOON Resource Report Resource Website |
RRID:Addgene_48699 | Kanamycin | Backbone Size:5775; Vector Backbone:pXOON; Vector Types:Mammalian Expression, Xenopus Oocyte Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 0 | |||||
|
SNF-5 pXOOM Resource Report Resource Website |
RRID:Addgene_48697 | snf-5 | Caenorhabditis elegans | Kanamycin | PMID:23580723 | Backbone Size:5052; Vector Backbone:pXOOM; Vector Types:Mammalian Expression, Xenopus Oocyte Expression; Bacterial Resistance:Kanamycin | K42E (when compared to NP_496735.1) | 2026-08-29 01:06:18 | 0 | |
|
AmCyan-P2A-Xerry Resource Report Resource Website |
RRID:Addgene_48686 | AmCyan | Synthetic | Kanamycin | the nAmCyan and the mCherry genes are separated by a P2A sequence that results in 2 separate proteins. It also includes BsmBI restriction sites flanking the nAmCyan gene which result in BsiWI and BssHII overhangs for cloning in-frame with P2A-mCherry. | Backbone Marker:clontech; Backbone Size:4000; Vector Backbone:pmR-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | SV40 NLS | 2026-08-29 01:06:18 | 0 | |
|
pLZL2372 Resource Report Resource Website |
RRID:Addgene_48683 | HIV Integrase | Kanamycin | PMID:23691126 | The depositing lab recommends bacteria strain Rosetta (DE3)pLysS for protein expression. Please contact [email protected] for additional information about this plasmid. | Vector Backbone:pET29a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 0 | ||
|
pLZL2386 Resource Report Resource Website |
RRID:Addgene_48682 | PFV Integrase | Kanamycin | PMID:23691126 | The depositing lab recommends bacteria strain Rosetta (DE3)pLysS for protein expression. Please contact [email protected] for additional information about this plasmid. | Vector Backbone:pET29a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 0 | ||
|
M-ST1-sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_48672 | sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter | Synthetic | Kanamycin | PMID:24076762 | Backbone Marker:Invitrogen; Vector Backbone:pCR-BluntII-TOPO; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 4 | ||
|
SK-YFP-TD-A Resource Report Resource Website |
RRID:Addgene_48666 | TD prototspacer A/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 0 | ||
|
SK-YFP-NM-A Resource Report Resource Website |
RRID:Addgene_48664 | NM prototspacer A/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 0 | ||
|
SK-YFP-TD-B Resource Report Resource Website |
RRID:Addgene_48663 | TD prototspacer B/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 0 | ||
|
SK-YFP-SPNM-B Resource Report Resource Website |
RRID:Addgene_48661 | SP/NM prototspacer B/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:06:18 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
